Incidental Mutation 'R7988:Col27a1'
ID 651579
Institutional Source Beutler Lab
Gene Symbol Col27a1
Ensembl Gene ENSMUSG00000045672
Gene Name collagen, type XXVII, alpha 1
Synonyms 5730512J02Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 63132246-63253228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63249559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1738 (H1738R)
Ref Sequence ENSEMBL: ENSMUSP00000043816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036300] [ENSMUST00000183913] [ENSMUST00000184067]
AlphaFold Q5QNQ9
Predicted Effect unknown
Transcript: ENSMUST00000036300
AA Change: H1738R
SMART Domains Protein: ENSMUSP00000043816
Gene: ENSMUSG00000045672
AA Change: H1738R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
TSPN 43 223 1.1e-5 SMART
low complexity region 325 343 N/A INTRINSIC
low complexity region 356 372 N/A INTRINSIC
low complexity region 428 443 N/A INTRINSIC
low complexity region 455 467 N/A INTRINSIC
low complexity region 584 597 N/A INTRINSIC
Pfam:Collagen 609 670 2.1e-10 PFAM
Pfam:Collagen 666 731 3.7e-10 PFAM
low complexity region 790 808 N/A INTRINSIC
low complexity region 817 838 N/A INTRINSIC
low complexity region 858 880 N/A INTRINSIC
low complexity region 886 910 N/A INTRINSIC
low complexity region 912 946 N/A INTRINSIC
Pfam:Collagen 1012 1080 2.8e-8 PFAM
Pfam:Collagen 1033 1103 3e-9 PFAM
Pfam:Collagen 1063 1130 3.4e-9 PFAM
low complexity region 1150 1168 N/A INTRINSIC
Pfam:Collagen 1207 1281 5.5e-9 PFAM
Pfam:Collagen 1261 1324 8.4e-10 PFAM
Pfam:Collagen 1323 1384 3.8e-12 PFAM
low complexity region 1438 1466 N/A INTRINSIC
internal_repeat_4 1467 1502 1.5e-7 PROSPERO
internal_repeat_2 1468 1529 1.96e-8 PROSPERO
Pfam:Collagen 1544 1606 2.4e-9 PFAM
COLFI 1644 1845 1.28e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183913
SMART Domains Protein: ENSMUSP00000139182
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 1 60 2.7e-12 PFAM
Pfam:Collagen 34 114 6.6e-8 PFAM
Pfam:Collagen 87 163 3.6e-9 PFAM
low complexity region 175 202 N/A INTRINSIC
low complexity region 214 232 N/A INTRINSIC
Pfam:Collagen 271 338 9.1e-11 PFAM
Pfam:Collagen 328 388 5.4e-11 PFAM
Pfam:Collagen 387 442 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184067
SMART Domains Protein: ENSMUSP00000139173
Gene: ENSMUSG00000045672

DomainStartEndE-ValueType
Pfam:Collagen 23 87 2.1e-8 PFAM
Pfam:Collagen 57 145 8.3e-8 PFAM
Pfam:Collagen 115 200 9.9e-8 PFAM
low complexity region 202 223 N/A INTRINSIC
low complexity region 243 265 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 331 N/A INTRINSIC
internal_repeat_1 337 442 5.17e-20 PROSPERO
Pfam:Collagen 448 515 1.5e-9 PFAM
Pfam:Collagen 478 543 2e-10 PFAM
Pfam:Collagen 502 566 2.5e-9 PFAM
Pfam:Collagen 532 617 4.4e-7 PFAM
Pfam:Collagen 594 660 8.2e-11 PFAM
Pfam:Collagen 649 709 1.4e-10 PFAM
Pfam:Collagen 708 769 2e-12 PFAM
Pfam:Collagen 752 829 5e-8 PFAM
Pfam:Collagen 878 939 2.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXVII collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein forms a homotrimeric triple helical procollagen that undergoes proteolytic processing during fibril formation. Transgenic mice lacking a portion of the collagenous domain in the encoded protein exhibit skeletal abnormalities, chondrodysplasia and die at birth because of a lung defect. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for an in frame deletion display neonatal lethality, respiratory failure, and severe chondrodysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Col27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Col27a1 APN 4 63,218,978 (GRCm39) splice site probably benign
IGL01461:Col27a1 APN 4 63,142,480 (GRCm39) missense probably damaging 1.00
IGL01534:Col27a1 APN 4 63,144,019 (GRCm39) missense probably benign 0.12
IGL01738:Col27a1 APN 4 63,182,016 (GRCm39) splice site probably benign
IGL01810:Col27a1 APN 4 63,143,868 (GRCm39) missense probably benign 0.21
IGL02127:Col27a1 APN 4 63,143,379 (GRCm39) missense possibly damaging 0.60
IGL02290:Col27a1 APN 4 63,144,163 (GRCm39) missense probably damaging 1.00
IGL02374:Col27a1 APN 4 63,211,486 (GRCm39) missense possibly damaging 0.86
IGL02548:Col27a1 APN 4 63,236,492 (GRCm39) splice site probably benign
IGL02792:Col27a1 APN 4 63,233,820 (GRCm39) missense unknown
IGL02931:Col27a1 APN 4 63,249,663 (GRCm39) utr 3 prime probably benign
IGL03107:Col27a1 APN 4 63,242,869 (GRCm39) splice site probably benign
IGL03121:Col27a1 APN 4 63,143,446 (GRCm39) missense probably benign 0.26
IGL03334:Col27a1 APN 4 63,232,959 (GRCm39) missense probably damaging 1.00
R0005:Col27a1 UTSW 4 63,143,637 (GRCm39) missense probably benign 0.04
R0025:Col27a1 UTSW 4 63,194,214 (GRCm39) missense probably damaging 1.00
R0141:Col27a1 UTSW 4 63,183,870 (GRCm39) critical splice acceptor site probably null
R0196:Col27a1 UTSW 4 63,142,503 (GRCm39) missense probably benign 0.02
R0359:Col27a1 UTSW 4 63,232,964 (GRCm39) critical splice donor site probably null
R0375:Col27a1 UTSW 4 63,143,898 (GRCm39) missense probably benign 0.23
R0432:Col27a1 UTSW 4 63,143,848 (GRCm39) missense possibly damaging 0.87
R0499:Col27a1 UTSW 4 63,218,978 (GRCm39) splice site probably benign
R0786:Col27a1 UTSW 4 63,209,815 (GRCm39) critical splice donor site probably null
R0891:Col27a1 UTSW 4 63,223,420 (GRCm39) critical splice acceptor site probably null
R1239:Col27a1 UTSW 4 63,237,152 (GRCm39) splice site probably benign
R1297:Col27a1 UTSW 4 63,183,868 (GRCm39) splice site probably benign
R1299:Col27a1 UTSW 4 63,183,868 (GRCm39) splice site probably benign
R1322:Col27a1 UTSW 4 63,246,803 (GRCm39) utr 3 prime probably benign
R1342:Col27a1 UTSW 4 63,175,351 (GRCm39) critical splice donor site probably null
R1446:Col27a1 UTSW 4 63,143,040 (GRCm39) missense probably damaging 1.00
R1629:Col27a1 UTSW 4 63,248,100 (GRCm39) utr 3 prime probably benign
R1644:Col27a1 UTSW 4 63,246,868 (GRCm39) utr 3 prime probably benign
R1774:Col27a1 UTSW 4 63,143,950 (GRCm39) missense probably damaging 1.00
R1807:Col27a1 UTSW 4 63,249,586 (GRCm39) utr 3 prime probably benign
R1952:Col27a1 UTSW 4 63,202,130 (GRCm39) splice site probably null
R1957:Col27a1 UTSW 4 63,196,031 (GRCm39) missense probably benign 0.03
R1970:Col27a1 UTSW 4 63,191,354 (GRCm39) splice site probably benign
R2164:Col27a1 UTSW 4 63,143,661 (GRCm39) missense probably benign 0.21
R3774:Col27a1 UTSW 4 63,232,963 (GRCm39) missense probably benign 0.00
R4078:Col27a1 UTSW 4 63,142,669 (GRCm39) missense probably damaging 1.00
R4353:Col27a1 UTSW 4 63,143,868 (GRCm39) missense probably benign 0.21
R4611:Col27a1 UTSW 4 63,211,743 (GRCm39) missense probably damaging 1.00
R4708:Col27a1 UTSW 4 63,202,150 (GRCm39) missense probably benign 0.01
R4884:Col27a1 UTSW 4 63,194,197 (GRCm39) missense possibly damaging 0.77
R5149:Col27a1 UTSW 4 63,249,664 (GRCm39) utr 3 prime probably benign
R5411:Col27a1 UTSW 4 63,142,902 (GRCm39) missense probably damaging 1.00
R5451:Col27a1 UTSW 4 63,143,476 (GRCm39) missense probably damaging 0.98
R5615:Col27a1 UTSW 4 63,199,351 (GRCm39) missense probably damaging 0.96
R5657:Col27a1 UTSW 4 63,143,547 (GRCm39) missense probably damaging 0.97
R5838:Col27a1 UTSW 4 63,143,765 (GRCm39) missense probably damaging 1.00
R6230:Col27a1 UTSW 4 63,142,519 (GRCm39) missense probably damaging 1.00
R6326:Col27a1 UTSW 4 63,242,678 (GRCm39) utr 3 prime probably benign
R6457:Col27a1 UTSW 4 63,237,701 (GRCm39) utr 3 prime probably benign
R6624:Col27a1 UTSW 4 63,143,248 (GRCm39) missense probably benign 0.00
R6792:Col27a1 UTSW 4 63,235,740 (GRCm39) missense unknown
R6848:Col27a1 UTSW 4 63,220,608 (GRCm39) missense probably benign
R6962:Col27a1 UTSW 4 63,237,738 (GRCm39) utr 3 prime probably benign
R7053:Col27a1 UTSW 4 63,251,404 (GRCm39) utr 3 prime probably benign
R7206:Col27a1 UTSW 4 63,153,583 (GRCm39) missense probably benign 0.29
R7586:Col27a1 UTSW 4 63,143,278 (GRCm39) missense probably damaging 1.00
R7698:Col27a1 UTSW 4 63,143,955 (GRCm39) missense possibly damaging 0.78
R7714:Col27a1 UTSW 4 63,242,723 (GRCm39) critical splice donor site probably null
R7916:Col27a1 UTSW 4 63,142,789 (GRCm39) missense probably damaging 1.00
R7943:Col27a1 UTSW 4 63,236,520 (GRCm39) missense unknown
R8136:Col27a1 UTSW 4 63,202,190 (GRCm39) missense probably benign 0.06
R8243:Col27a1 UTSW 4 63,144,120 (GRCm39) missense probably damaging 1.00
R8245:Col27a1 UTSW 4 63,144,040 (GRCm39) missense probably damaging 0.97
R8350:Col27a1 UTSW 4 63,248,134 (GRCm39) missense unknown
R8437:Col27a1 UTSW 4 63,237,701 (GRCm39) utr 3 prime probably benign
R8450:Col27a1 UTSW 4 63,248,134 (GRCm39) missense unknown
R8542:Col27a1 UTSW 4 63,239,662 (GRCm39) splice site probably null
R8745:Col27a1 UTSW 4 63,144,153 (GRCm39) missense probably benign 0.02
R8821:Col27a1 UTSW 4 63,143,148 (GRCm39) missense probably benign 0.04
R8951:Col27a1 UTSW 4 63,191,311 (GRCm39) missense possibly damaging 0.92
R8970:Col27a1 UTSW 4 63,134,105 (GRCm39) missense unknown
R9115:Col27a1 UTSW 4 63,231,974 (GRCm39) missense unknown
R9185:Col27a1 UTSW 4 63,246,887 (GRCm39) missense unknown
R9291:Col27a1 UTSW 4 63,142,539 (GRCm39) missense probably damaging 0.99
R9404:Col27a1 UTSW 4 63,194,178 (GRCm39) missense possibly damaging 0.93
Z1176:Col27a1 UTSW 4 63,144,025 (GRCm39) missense probably damaging 0.99
Z1177:Col27a1 UTSW 4 63,199,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGGATTGAACAGCCAC -3'
(R):5'- GCCATCCATAGACACCTCTG -3'

Sequencing Primer
(F):5'- AGCTCATGGAGAACTCAGTTTTCCTG -3'
(R):5'- TAGACACCTCTGGCCTGAACTG -3'
Posted On 2020-09-15