Incidental Mutation 'R7988:Ago1'
ID 651581
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.810) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126328805-126362376 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126354210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 200 (F200S)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably damaging
Transcript: ENSMUST00000097888
AA Change: F200S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: F200S

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,353,610 (GRCm39) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,333,324 (GRCm39) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,347,433 (GRCm39) nonsense probably null
IGL02810:Ago1 APN 4 126,336,886 (GRCm39) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,355,587 (GRCm39) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,352,982 (GRCm39) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,336,964 (GRCm39) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,353,796 (GRCm39) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,357,484 (GRCm39) missense probably benign 0.01
R0244:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126,336,959 (GRCm39) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,333,388 (GRCm39) missense probably benign
R0557:Ago1 UTSW 4 126,353,817 (GRCm39) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,347,426 (GRCm39) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,334,194 (GRCm39) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,357,534 (GRCm39) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,333,788 (GRCm39) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,335,029 (GRCm39) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,348,187 (GRCm39) missense probably null 0.36
R2051:Ago1 UTSW 4 126,354,246 (GRCm39) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,355,581 (GRCm39) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,357,650 (GRCm39) splice site probably null
R2256:Ago1 UTSW 4 126,335,704 (GRCm39) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,347,443 (GRCm39) missense probably benign 0.01
R2517:Ago1 UTSW 4 126,333,732 (GRCm39) nonsense probably null
R2850:Ago1 UTSW 4 126,336,868 (GRCm39) splice site probably benign
R2993:Ago1 UTSW 4 126,333,839 (GRCm39) splice site probably benign
R3746:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3747:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3750:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R4600:Ago1 UTSW 4 126,354,185 (GRCm39) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,342,652 (GRCm39) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,347,447 (GRCm39) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,347,397 (GRCm39) missense probably benign 0.01
R5132:Ago1 UTSW 4 126,355,516 (GRCm39) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,335,008 (GRCm39) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,354,830 (GRCm39) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,342,587 (GRCm39) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,354,362 (GRCm39) unclassified probably benign
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,342,601 (GRCm39) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,357,628 (GRCm39) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,348,145 (GRCm39) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,354,215 (GRCm39) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,333,298 (GRCm39) makesense probably null
R7496:Ago1 UTSW 4 126,355,545 (GRCm39) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,347,701 (GRCm39) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,337,022 (GRCm39) missense probably benign 0.18
R8041:Ago1 UTSW 4 126,335,729 (GRCm39) missense probably damaging 1.00
R8073:Ago1 UTSW 4 126,337,019 (GRCm39) missense probably benign 0.04
R8086:Ago1 UTSW 4 126,354,774 (GRCm39) missense probably benign
R8127:Ago1 UTSW 4 126,348,214 (GRCm39) missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126,354,316 (GRCm39) unclassified probably benign
R8878:Ago1 UTSW 4 126,357,516 (GRCm39) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,357,583 (GRCm39) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,336,977 (GRCm39) missense probably benign
X0025:Ago1 UTSW 4 126,336,908 (GRCm39) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,347,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGCTCAGATTCTTTCAG -3'
(R):5'- TGGCCCCATCCTTAGATACC -3'

Sequencing Primer
(F):5'- TTTATATTCTCTTCTTTGTAGGGCAC -3'
(R):5'- AGGTCAGTCTTACTATTGGCCCAAG -3'
Posted On 2020-09-15