Incidental Mutation 'R7988:Ppef2'
ID651582
Institutional Source Beutler Lab
Gene Symbol Ppef2
Ensembl Gene ENSMUSG00000029410
Gene Nameprotein phosphatase, EF hand calcium-binding domain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92226679-92256278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92238982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 365 (F365L)
Ref Sequence ENSEMBL: ENSMUSP00000031359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]
Predicted Effect probably benign
Transcript: ENSMUST00000031359
AA Change: F365L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: F365L

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201130
AA Change: F365L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: F365L

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Ppef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ppef2 APN 5 92234237 missense probably damaging 1.00
IGL01105:Ppef2 APN 5 92249196 missense possibly damaging 0.91
IGL01613:Ppef2 APN 5 92235820 missense probably benign 0.01
IGL01793:Ppef2 APN 5 92246756 missense probably damaging 1.00
IGL02529:Ppef2 APN 5 92244737 missense probably damaging 1.00
IGL02702:Ppef2 APN 5 92231819 missense probably benign 0.01
IGL02992:Ppef2 APN 5 92235900 nonsense probably null
IGL02995:Ppef2 APN 5 92235900 nonsense probably null
IGL02996:Ppef2 APN 5 92235900 nonsense probably null
IGL03169:Ppef2 APN 5 92235900 nonsense probably null
IGL02991:Ppef2 UTSW 5 92235900 nonsense probably null
R0494:Ppef2 UTSW 5 92253093 splice site probably benign
R0659:Ppef2 UTSW 5 92230509 missense probably damaging 1.00
R0781:Ppef2 UTSW 5 92244830 missense probably benign 0.39
R1162:Ppef2 UTSW 5 92253121 missense probably benign 0.00
R1870:Ppef2 UTSW 5 92250512 missense probably damaging 1.00
R2212:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R2973:Ppef2 UTSW 5 92239094 missense probably benign
R3412:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3413:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3745:Ppef2 UTSW 5 92239151 splice site probably benign
R4878:Ppef2 UTSW 5 92228740 splice site probably null
R5027:Ppef2 UTSW 5 92234291 missense probably damaging 1.00
R5156:Ppef2 UTSW 5 92244602 critical splice donor site probably null
R5316:Ppef2 UTSW 5 92235811 missense probably benign 0.00
R5590:Ppef2 UTSW 5 92239139 missense probably damaging 0.99
R5773:Ppef2 UTSW 5 92250561 missense probably damaging 1.00
R5881:Ppef2 UTSW 5 92250529 nonsense probably null
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6182:Ppef2 UTSW 5 92227066 missense probably damaging 1.00
R6335:Ppef2 UTSW 5 92235754 missense probably damaging 1.00
R6645:Ppef2 UTSW 5 92230461 missense probably benign 0.02
R7448:Ppef2 UTSW 5 92228704 missense probably damaging 1.00
R7576:Ppef2 UTSW 5 92253134 missense possibly damaging 0.87
R7968:Ppef2 UTSW 5 92249163 missense probably damaging 0.99
R8200:Ppef2 UTSW 5 92245392 missense probably benign 0.13
R8212:Ppef2 UTSW 5 92228665 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AACACAGTCAGCATCTGGGG -3'
(R):5'- CCCAGAACAGTAGTCTGAAAGG -3'

Sequencing Primer
(F):5'- TCAGCATCTGGGGCCAAAG -3'
(R):5'- ACAGTAGTCTGAAAGGACTTACC -3'
Posted On2020-09-15