Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Zcwpw1'

651583

Institutional Source

Beutler Lab

Gene Symbol

Zcwpw1

Ensembl Gene

ENSMUSG00000037108

Gene Name

zinc finger, CW type with PWWP domain 1

Synonyms

LOC381678

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137787798-137822621 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 137817491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 419 (Y419D)

Ref Sequence

ENSEMBL: ENSMUSP00000048730 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035852] [ENSMUST00000058897]

AlphaFold

Q6IR42

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035852
AA Change: Y419D

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000048730
Gene: ENSMUSG00000037108
AA Change: Y419D

Domain	Start	End	E-Value	Type
Pfam:zf-CW	246	293	7.3e-18	PFAM
Pfam:PWWP	306	401	6.9e-22	PFAM
coiled coil region	440	462	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058897

SMART Domains

Protein: ENSMUSP00000050313
Gene: ENSMUSG00000046245

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Blast:IG	45	155	3e-69	BLAST
low complexity region	156	176	N/A	INTRINSIC
transmembrane domain	197	219	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120909
Gene: ENSMUSG00000037108
AA Change: Y105D

Domain	Start	End	E-Value	Type
Pfam:PWWP	21	109	8.2e-19	PFAM
coiled coil region	126	148	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Zcwpw1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01296:Zcwpw1	APN	5	137796799	missense	probably benign	0.42
IGL02316:Zcwpw1	APN	5	137810010	unclassified	probably benign
IGL02336:Zcwpw1	APN	5	137810114	missense	probably damaging	0.96
R0103:Zcwpw1	UTSW	5	137810113	nonsense	probably null
R0103:Zcwpw1	UTSW	5	137810113	nonsense	probably null
R0295:Zcwpw1	UTSW	5	137817472	missense	probably damaging	1.00
R0514:Zcwpw1	UTSW	5	137796683	missense	probably benign	0.26
R0685:Zcwpw1	UTSW	5	137799592	missense	probably benign	0.00
R0698:Zcwpw1	UTSW	5	137817521	missense	probably benign
R0727:Zcwpw1	UTSW	5	137810807	unclassified	probably benign
R1677:Zcwpw1	UTSW	5	137796760	missense	probably damaging	0.99
R1780:Zcwpw1	UTSW	5	137796652	missense	probably damaging	0.98
R1938:Zcwpw1	UTSW	5	137811622	missense	probably damaging	0.99
R2875:Zcwpw1	UTSW	5	137810042	missense	probably damaging	1.00
R4177:Zcwpw1	UTSW	5	137800133	missense	probably damaging	0.99
R5073:Zcwpw1	UTSW	5	137795519	start codon destroyed	probably null	0.81
R5913:Zcwpw1	UTSW	5	137800007	missense	probably benign	0.31
R6224:Zcwpw1	UTSW	5	137812036	missense	possibly damaging	0.63
R6542:Zcwpw1	UTSW	5	137812020	missense	probably damaging	0.98
R7204:Zcwpw1	UTSW	5	137812084	missense	probably damaging	0.98
R7542:Zcwpw1	UTSW	5	137819523	missense	probably benign	0.00
R7600:Zcwpw1	UTSW	5	137800134	nonsense	probably null
R7911:Zcwpw1	UTSW	5	137796770	missense	probably null	1.00
R7972:Zcwpw1	UTSW	5	137801061	missense	probably benign	0.13
R8174:Zcwpw1	UTSW	5	137819577	critical splice donor site	probably null
R8713:Zcwpw1	UTSW	5	137799532	missense	probably benign	0.06
R8851:Zcwpw1	UTSW	5	137822364	missense	probably damaging	1.00
R9016:Zcwpw1	UTSW	5	137800078	missense	probably damaging	0.98
R9131:Zcwpw1	UTSW	5	137810920	missense	probably damaging	1.00
R9337:Zcwpw1	UTSW	5	137801012	missense	probably benign	0.37
X0021:Zcwpw1	UTSW	5	137811607	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTGACATGTGAGTTTCTCTTTCC -3'
(R):5'- ACGTCACCATGGTCCTACAG -3'

Sequencing Primer
(F):5'- GTCATTTGTTCCATCATGAATCAAC -3'
(R):5'- TGGTCCTACAGATCATGACTCAC -3'

Posted On

2020-09-15