Incidental Mutation 'R7988:Klhdc10'
ID651584
Institutional Source Beutler Lab
Gene Symbol Klhdc10
Ensembl Gene ENSMUSG00000029775
Gene Namekelch domain containing 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30401868-30455179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30446691 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 282 (S282P)
Ref Sequence ENSEMBL: ENSMUSP00000069669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068240] [ENSMUST00000068259] [ENSMUST00000123494] [ENSMUST00000132581] [ENSMUST00000135566] [ENSMUST00000144272]
Predicted Effect probably benign
Transcript: ENSMUST00000068240
AA Change: S253P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064594
Gene: ENSMUSG00000029775
AA Change: S253P

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 56 107 3.6e-7 PFAM
Pfam:Kelch_1 59 114 5.6e-8 PFAM
Pfam:Kelch_4 59 120 1.8e-7 PFAM
Pfam:Kelch_6 59 120 2.1e-8 PFAM
Pfam:Kelch_4 173 222 9.8e-9 PFAM
Pfam:Kelch_6 173 225 3.9e-9 PFAM
Pfam:Kelch_2 174 218 1.2e-7 PFAM
Pfam:Kelch_1 174 219 9.4e-8 PFAM
Kelch 239 294 4.93e0 SMART
Kelch 295 342 9.96e-4 SMART
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068259
AA Change: S282P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069669
Gene: ENSMUSG00000029775
AA Change: S282P

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 85 135 1.2e-7 PFAM
Pfam:Kelch_1 88 143 2.6e-8 PFAM
Pfam:Kelch_4 88 149 1.5e-6 PFAM
Pfam:Kelch_6 88 150 3.1e-8 PFAM
Pfam:Kelch_6 202 255 4.6e-9 PFAM
Pfam:Kelch_2 203 247 1.4e-7 PFAM
Pfam:Kelch_1 203 248 2.6e-6 PFAM
Kelch 268 323 4.93e0 SMART
Kelch 324 371 9.96e-4 SMART
low complexity region 402 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123494
AA Change: S142P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145442
Gene: ENSMUSG00000029775
AA Change: S142P

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 1.2e-4 PFAM
Pfam:Kelch_6 62 115 5.2e-8 PFAM
Pfam:Kelch_2 63 107 1.6e-6 PFAM
Pfam:Kelch_1 63 108 3.1e-5 PFAM
Pfam:Kelch_1 116 157 2.1e-6 PFAM
Pfam:Kelch_6 116 157 8.8e-6 PFAM
Pfam:Kelch_4 122 157 3.7e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132581
AA Change: S200P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143839
Gene: ENSMUSG00000029775
AA Change: S200P

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
Pfam:Kelch_2 121 165 1.1e-6 PFAM
Pfam:Kelch_6 121 173 2.4e-8 PFAM
Pfam:Kelch_1 123 166 2.1e-5 PFAM
Pfam:Kelch_4 123 168 9.8e-5 PFAM
Kelch 186 241 1.7e-2 SMART
Kelch 242 289 3.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135566
SMART Domains Protein: ENSMUSP00000144878
Gene: ENSMUSG00000029775

DomainStartEndE-ValueType
Blast:Kelch 1 21 4e-6 BLAST
SCOP:d1k3ia3 7 51 1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144272
AA Change: S142P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145063
Gene: ENSMUSG00000029775
AA Change: S142P

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 3.5e-4 PFAM
Pfam:Kelch_6 62 115 1.6e-7 PFAM
Pfam:Kelch_2 63 107 4.8e-6 PFAM
Pfam:Kelch_1 63 108 9.1e-5 PFAM
Kelch 128 183 1.7e-2 SMART
Kelch 184 231 3.3e-6 SMART
low complexity region 262 273 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Klhdc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Klhdc10 APN 6 30441934 splice site probably null
IGL02313:Klhdc10 APN 6 30439866 critical splice donor site probably null
IGL03353:Klhdc10 APN 6 30447992 splice site probably benign
PIT4378001:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R0379:Klhdc10 UTSW 6 30450670 missense possibly damaging 0.89
R0390:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R1199:Klhdc10 UTSW 6 30449494 missense probably damaging 1.00
R1628:Klhdc10 UTSW 6 30444462 missense probably damaging 0.98
R2243:Klhdc10 UTSW 6 30449559 missense probably damaging 1.00
R2861:Klhdc10 UTSW 6 30402140 missense unknown
R5007:Klhdc10 UTSW 6 30450641 missense probably benign 0.05
R5574:Klhdc10 UTSW 6 30439865 missense possibly damaging 0.92
R6428:Klhdc10 UTSW 6 30439856 missense probably damaging 1.00
R6724:Klhdc10 UTSW 6 30446641 missense probably damaging 0.99
R6842:Klhdc10 UTSW 6 30439782 missense probably damaging 1.00
R6879:Klhdc10 UTSW 6 30449590 missense probably damaging 1.00
R7014:Klhdc10 UTSW 6 30450503 missense probably damaging 1.00
R7124:Klhdc10 UTSW 6 30441827 missense probably damaging 1.00
R7453:Klhdc10 UTSW 6 30447990 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAACTTCTGAGTGGATTAGCC -3'
(R):5'- AGCTCTGAGTGCAACCTTCTG -3'

Sequencing Primer
(F):5'- CAGTTCACTGCTGGTTAACACTTAG -3'
(R):5'- GAGTGCAACCTTCTGTCACAG -3'
Posted On2020-09-15