Incidental Mutation 'R7988:Repin1'
ID 651585
Institutional Source Beutler Lab
Gene Symbol Repin1
Ensembl Gene ENSMUSG00000052751
Gene Name replication initiator 1
Synonyms Zfp464, AP4, E430037F08Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 48570817-48576016 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 48574279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 403 (E403*)
Ref Sequence ENSEMBL: ENSMUSP00000118890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009420] [ENSMUST00000118229] [ENSMUST00000135151] [ENSMUST00000154010] [ENSMUST00000163452] [ENSMUST00000204095] [ENSMUST00000204121] [ENSMUST00000204521]
AlphaFold Q5U4E2
Predicted Effect probably null
Transcript: ENSMUST00000009420
AA Change: E347*
SMART Domains Protein: ENSMUSP00000009420
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118229
AA Change: E400*
SMART Domains Protein: ENSMUSP00000113548
Gene: ENSMUSG00000052751
AA Change: E400*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135151
AA Change: E403*
SMART Domains Protein: ENSMUSP00000118890
Gene: ENSMUSG00000052751
AA Change: E403*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
Pfam:zf-C2H2_6 284 300 1.4e-1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154010
AA Change: E347*
SMART Domains Protein: ENSMUSP00000121975
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163452
AA Change: E347*
SMART Domains Protein: ENSMUSP00000132365
Gene: ENSMUSG00000052751
AA Change: E347*

DomainStartEndE-ValueType
ZnF_C2H2 52 72 3.47e1 SMART
ZnF_C2H2 80 102 5.81e-2 SMART
ZnF_C2H2 111 133 5.5e-3 SMART
ZnF_C2H2 140 160 1.16e1 SMART
ZnF_C2H2 172 194 3.89e-3 SMART
low complexity region 196 224 N/A INTRINSIC
ZnF_C2H2 229 251 1.67e-2 SMART
ZnF_C2H2 257 279 4.94e-5 SMART
ZnF_C2H2 285 307 5.21e-4 SMART
ZnF_C2H2 353 375 4.72e-2 SMART
ZnF_C2H2 381 403 1.26e-2 SMART
ZnF_C2H2 409 431 1.79e-2 SMART
ZnF_C2H2 437 459 4.24e-4 SMART
ZnF_C2H2 465 487 6.52e-5 SMART
ZnF_C2H2 493 515 2.61e-4 SMART
ZnF_C2H2 521 543 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204095
SMART Domains Protein: ENSMUSP00000145192
Gene: ENSMUSG00000007216

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
ZnF_C2H2 104 126 7.9e-4 SMART
ZnF_C2H2 132 154 1.69e-3 SMART
ZnF_C2H2 160 182 2.36e-2 SMART
ZnF_C2H2 188 210 4.11e-2 SMART
ZnF_C2H2 279 301 1.84e-4 SMART
ZnF_C2H2 307 329 4.94e-5 SMART
ZnF_C2H2 335 357 2.95e-3 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 446 468 1.3e-4 SMART
ZnF_C2H2 474 496 2.12e-4 SMART
ZnF_C2H2 502 524 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204121
Predicted Effect probably benign
Transcript: ENSMUST00000204521
Meta Mutation Damage Score 0.9647 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele improves in insulin sensitivity and glucose metabolism in Leprdb homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Repin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Repin1 APN 6 48,573,839 (GRCm39) missense probably damaging 1.00
IGL01103:Repin1 APN 6 48,574,887 (GRCm39) intron probably benign
IGL02027:Repin1 APN 6 48,573,407 (GRCm39) missense probably damaging 1.00
IGL02143:Repin1 APN 6 48,574,055 (GRCm39) missense probably damaging 1.00
R0395:Repin1 UTSW 6 48,574,459 (GRCm39) missense probably damaging 1.00
R1233:Repin1 UTSW 6 48,574,768 (GRCm39) missense possibly damaging 0.72
R1743:Repin1 UTSW 6 48,574,684 (GRCm39) missense probably damaging 0.96
R2259:Repin1 UTSW 6 48,573,464 (GRCm39) missense probably benign 0.00
R4509:Repin1 UTSW 6 48,573,460 (GRCm39) missense possibly damaging 0.77
R5008:Repin1 UTSW 6 48,573,542 (GRCm39) missense probably damaging 1.00
R5009:Repin1 UTSW 6 48,571,779 (GRCm39) intron probably benign
R5425:Repin1 UTSW 6 48,573,365 (GRCm39) missense probably benign 0.18
R5829:Repin1 UTSW 6 48,571,766 (GRCm39) intron probably benign
R6350:Repin1 UTSW 6 48,574,562 (GRCm39) missense probably damaging 0.98
R6841:Repin1 UTSW 6 48,574,859 (GRCm39) missense possibly damaging 0.95
R6854:Repin1 UTSW 6 48,570,825 (GRCm39) intron probably benign
R7067:Repin1 UTSW 6 48,574,850 (GRCm39) nonsense probably null
R7636:Repin1 UTSW 6 48,573,299 (GRCm39) missense probably benign 0.00
R7699:Repin1 UTSW 6 48,574,756 (GRCm39) missense probably damaging 0.96
R7700:Repin1 UTSW 6 48,574,756 (GRCm39) missense probably damaging 0.96
R7747:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7748:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7781:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7815:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7820:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7869:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R7991:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8078:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8079:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8080:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8088:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8089:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8130:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8131:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8324:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8325:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8342:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8411:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8488:Repin1 UTSW 6 48,570,952 (GRCm39) missense probably damaging 0.98
R8542:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8543:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8544:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8697:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8699:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8701:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8702:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8731:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8732:Repin1 UTSW 6 48,574,279 (GRCm39) nonsense probably null
R8780:Repin1 UTSW 6 48,574,073 (GRCm39) missense probably damaging 0.99
R8879:Repin1 UTSW 6 48,574,367 (GRCm39) missense possibly damaging 0.73
R9049:Repin1 UTSW 6 48,574,646 (GRCm39) missense possibly damaging 0.86
R9465:Repin1 UTSW 6 48,571,877 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCATACATACCGGCGAGAAG -3'
(R):5'- CACATAGGGTTTCTCGCCTG -3'

Sequencing Primer
(F):5'- TACCCATGCACCGAGTGTGG -3'
(R):5'- TGGCTGCCCTGTGAGAAAC -3'
Posted On 2020-09-15