Incidental Mutation 'R7988:0610030E20Rik'
List |< first << previous [record 58 of 518619] next >> last >|
ID651587
Institutional Source Beutler Lab
Gene Symbol 0610030E20Rik
Ensembl Gene ENSMUSG00000058706
Gene NameRIKEN cDNA 0610030E20 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location72347317-72353148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72347652 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 56 (T56M)
Ref Sequence ENSEMBL: ENSMUSP00000076957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345] [ENSMUST00000077783]
Predicted Effect probably benign
Transcript: ENSMUST00000070345
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077783
AA Change: T56M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706
AA Change: T56M

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206262
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in 0610030E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5664:0610030E20Rik UTSW 6 72348994 splice site probably null
R6170:0610030E20Rik UTSW 6 72348572 missense probably benign 0.00
R6284:0610030E20Rik UTSW 6 72347454 missense probably damaging 1.00
R8228:0610030E20Rik UTSW 6 72347517 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGGCTTCGTACACCACATC -3'
(R):5'- GGTCCCAGCTACCTTATATAACAG -3'

Sequencing Primer
(F):5'- TCGTACACCACATCCGTCGG -3'
(R):5'- ATAACAGTGCAGTTTAACTGGGGTC -3'
Posted On2020-09-15