Incidental Mutation 'R7988:Eps8'
ID 651588
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Name epidermal growth factor receptor pathway substrate 8
Synonyms
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.370) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 137454242-137626262 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 137505569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 53 (R53Q)
Ref Sequence ENSEMBL: ENSMUSP00000052776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000132920] [ENSMUST00000146442] [ENSMUST00000147526]
AlphaFold Q08509
PDB Structure THE SH3 DOMAIN OF EPS8 EXISTS AS A NOVEL INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 DOMAIN INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 CLOSED MONOMER [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058210
AA Change: R53Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766
AA Change: R53Q

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000100841
AA Change: R53Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766
AA Change: R53Q

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000111878
AA Change: R53Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766
AA Change: R53Q

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000132920
AA Change: R70Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122517
Gene: ENSMUSG00000015766
AA Change: R70Q

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
PTB 77 214 8.38e-34 SMART
low complexity region 220 238 N/A INTRINSIC
low complexity region 246 258 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146442
AA Change: R53Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119997
Gene: ENSMUSG00000015766
AA Change: R53Q

DomainStartEndE-ValueType
PTB 60 188 3.18e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147526
AA Change: R53Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766
AA Change: R53Q

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137,482,477 (GRCm39) missense probably benign 0.00
IGL00499:Eps8 APN 6 137,499,886 (GRCm39) nonsense probably null
IGL01587:Eps8 APN 6 137,491,711 (GRCm39) missense probably damaging 1.00
IGL01789:Eps8 APN 6 137,516,364 (GRCm39) missense probably benign 0.01
IGL01836:Eps8 APN 6 137,460,539 (GRCm39) critical splice donor site probably null
IGL01951:Eps8 APN 6 137,514,669 (GRCm39) missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137,499,840 (GRCm39) missense probably benign 0.05
IGL02546:Eps8 APN 6 137,456,064 (GRCm39) missense probably benign 0.30
IGL02861:Eps8 APN 6 137,476,597 (GRCm39) missense probably damaging 1.00
IGL03115:Eps8 APN 6 137,504,379 (GRCm39) missense probably damaging 1.00
IGL03355:Eps8 APN 6 137,489,143 (GRCm39) splice site probably benign
FR4589:Eps8 UTSW 6 137,494,067 (GRCm39) frame shift probably null
R0113:Eps8 UTSW 6 137,514,682 (GRCm39) missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137,456,126 (GRCm39) missense probably benign 0.01
R0462:Eps8 UTSW 6 137,491,309 (GRCm39) missense probably benign 0.00
R0905:Eps8 UTSW 6 137,491,305 (GRCm39) missense probably benign 0.23
R1106:Eps8 UTSW 6 137,491,322 (GRCm39) missense probably damaging 1.00
R1178:Eps8 UTSW 6 137,499,852 (GRCm39) missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137,499,852 (GRCm39) missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137,499,852 (GRCm39) missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137,477,616 (GRCm39) missense probably benign 0.00
R1835:Eps8 UTSW 6 137,499,277 (GRCm39) nonsense probably null
R2068:Eps8 UTSW 6 137,499,172 (GRCm39) missense probably benign 0.13
R2113:Eps8 UTSW 6 137,514,633 (GRCm39) splice site probably null
R2943:Eps8 UTSW 6 137,499,870 (GRCm39) missense probably damaging 1.00
R3032:Eps8 UTSW 6 137,489,175 (GRCm39) missense probably damaging 0.96
R3879:Eps8 UTSW 6 137,504,360 (GRCm39) splice site probably benign
R3973:Eps8 UTSW 6 137,486,153 (GRCm39) missense probably benign 0.00
R4199:Eps8 UTSW 6 137,491,325 (GRCm39) missense probably damaging 0.96
R4384:Eps8 UTSW 6 137,476,590 (GRCm39) missense probably benign 0.30
R4728:Eps8 UTSW 6 137,486,160 (GRCm39) nonsense probably null
R4840:Eps8 UTSW 6 137,504,128 (GRCm39) missense probably damaging 1.00
R4860:Eps8 UTSW 6 137,491,293 (GRCm39) missense probably damaging 0.97
R4860:Eps8 UTSW 6 137,491,293 (GRCm39) missense probably damaging 0.97
R4864:Eps8 UTSW 6 137,455,967 (GRCm39) utr 3 prime probably benign
R5197:Eps8 UTSW 6 137,467,289 (GRCm39) missense possibly damaging 0.91
R5197:Eps8 UTSW 6 137,467,288 (GRCm39) missense probably damaging 0.97
R5214:Eps8 UTSW 6 137,504,490 (GRCm39) missense probably damaging 0.99
R5457:Eps8 UTSW 6 137,489,175 (GRCm39) missense probably damaging 0.96
R5464:Eps8 UTSW 6 137,504,473 (GRCm39) missense probably damaging 1.00
R5557:Eps8 UTSW 6 137,456,094 (GRCm39) missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137,459,208 (GRCm39) missense probably damaging 0.98
R6150:Eps8 UTSW 6 137,494,172 (GRCm39) missense probably damaging 1.00
R6473:Eps8 UTSW 6 137,456,096 (GRCm39) missense probably damaging 1.00
R6529:Eps8 UTSW 6 137,491,335 (GRCm39) missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137,460,596 (GRCm39) nonsense probably null
R6890:Eps8 UTSW 6 137,489,255 (GRCm39) missense probably damaging 0.99
R7180:Eps8 UTSW 6 137,456,072 (GRCm39) missense possibly damaging 0.78
R7229:Eps8 UTSW 6 137,516,354 (GRCm39) missense probably benign
R7314:Eps8 UTSW 6 137,504,090 (GRCm39) missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137,486,211 (GRCm39) missense possibly damaging 0.75
R7784:Eps8 UTSW 6 137,476,585 (GRCm39) missense probably benign 0.01
R7942:Eps8 UTSW 6 137,507,575 (GRCm39) missense possibly damaging 0.53
R7989:Eps8 UTSW 6 137,505,569 (GRCm39) missense possibly damaging 0.95
R7991:Eps8 UTSW 6 137,505,569 (GRCm39) missense possibly damaging 0.95
R8235:Eps8 UTSW 6 137,460,576 (GRCm39) missense possibly damaging 0.62
R8262:Eps8 UTSW 6 137,459,252 (GRCm39) missense probably benign 0.10
R8834:Eps8 UTSW 6 137,504,306 (GRCm39) intron probably benign
R8902:Eps8 UTSW 6 137,489,175 (GRCm39) missense probably damaging 1.00
R9081:Eps8 UTSW 6 137,504,415 (GRCm39) missense probably benign 0.02
R9225:Eps8 UTSW 6 137,507,561 (GRCm39) missense probably benign 0.18
RF025:Eps8 UTSW 6 137,494,064 (GRCm39) critical splice donor site probably benign
RF028:Eps8 UTSW 6 137,494,061 (GRCm39) critical splice donor site probably benign
RF035:Eps8 UTSW 6 137,494,068 (GRCm39) frame shift probably null
RF039:Eps8 UTSW 6 137,494,068 (GRCm39) frame shift probably null
RF046:Eps8 UTSW 6 137,494,061 (GRCm39) critical splice donor site probably benign
RF057:Eps8 UTSW 6 137,494,062 (GRCm39) critical splice donor site probably benign
Z1177:Eps8 UTSW 6 137,476,579 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAAAGGAAGGCCACACAACTG -3'
(R):5'- AGGTTCCTGCACACCGTTAG -3'

Sequencing Primer
(F):5'- GGAAGGCCACACAACTGAAAAC -3'
(R):5'- CCTGTGAGTCATGAGTACTTTCAGAC -3'
Posted On 2020-09-15