Incidental Mutation 'R7988:Zfp446'
ID651589
Institutional Source Beutler Lab
Gene Symbol Zfp446
Ensembl Gene ENSMUSG00000033961
Gene Namezinc finger protein 446
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12977848-12985714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12979043 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 103 (S103T)
Ref Sequence ENSEMBL: ENSMUSP00000039073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045810] [ENSMUST00000108535] [ENSMUST00000108536] [ENSMUST00000108537] [ENSMUST00000124387]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045810
AA Change: S103T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961
AA Change: S103T

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108535
AA Change: S3T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104175
Gene: ENSMUSG00000033961
AA Change: S3T

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 254 1.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108536
AA Change: S3T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961
AA Change: S3T

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108537
AA Change: S3T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104177
Gene: ENSMUSG00000033961
AA Change: S3T

DomainStartEndE-ValueType
SCAN 22 128 7.37e-49 SMART
KRAB 124 185 3.96e-2 SMART
ZnF_C2H2 244 266 2.95e-3 SMART
ZnF_C2H2 293 315 8.47e-4 SMART
ZnF_C2H2 321 343 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Other mutations in Zfp446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Zfp446 APN 7 12979380 critical splice donor site probably null
IGL01534:Zfp446 APN 7 12979566 missense probably damaging 1.00
IGL02471:Zfp446 APN 7 12982254 missense probably benign 0.41
IGL02888:Zfp446 APN 7 12979328 missense probably damaging 1.00
IGL03153:Zfp446 APN 7 12977907 missense probably benign 0.01
IGL03185:Zfp446 APN 7 12978998 missense probably null 0.43
IGL03242:Zfp446 APN 7 12979325 missense probably damaging 1.00
R0538:Zfp446 UTSW 7 12979589 missense possibly damaging 0.94
R1809:Zfp446 UTSW 7 12979121 missense probably damaging 1.00
R3686:Zfp446 UTSW 7 12982653 missense probably damaging 0.97
R3701:Zfp446 UTSW 7 12978152 unclassified probably benign
R5256:Zfp446 UTSW 7 12979304 nonsense probably null
R5363:Zfp446 UTSW 7 12978057 missense probably benign 0.20
R5377:Zfp446 UTSW 7 12982251 missense possibly damaging 0.88
R6806:Zfp446 UTSW 7 12979116 missense probably damaging 1.00
R7167:Zfp446 UTSW 7 12978122 unclassified probably benign
R8288:Zfp446 UTSW 7 12977958 missense probably benign 0.00
R8487:Zfp446 UTSW 7 12982628 missense possibly damaging 0.68
R8943:Zfp446 UTSW 7 12979637 nonsense probably null
Z1177:Zfp446 UTSW 7 12978166 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGTTTTCTAGAAGGTCCCTG -3'
(R):5'- AGGATGACTCAGGCTGTAGC -3'

Sequencing Primer
(F):5'- AGGTCCCTGGACATTCCAC -3'
(R):5'- TGTAGCCACTGGTGACACAACTC -3'
Posted On2020-09-15