Incidental Mutation 'R7988:Setd1a'
ID651592
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene NameSET domain containing 1A
SynonymsKMT2F
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127776670-127800122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127786194 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 691 (M691K)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
Predicted Effect probably benign
Transcript: ENSMUST00000047075
AA Change: M691K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: M691K

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
AA Change: M691K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: M691K

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
AA Change: M148K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127797698 unclassified probably benign
IGL02657:Setd1a APN 7 127795825 unclassified probably benign
IGL02792:Setd1a APN 7 127791350 missense unknown
IGL02876:Setd1a APN 7 127778501 splice site probably benign
IGL02967:Setd1a APN 7 127785177 unclassified probably benign
IGL03090:Setd1a APN 7 127786500 missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127785546 missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127785326 unclassified probably benign
FR4548:Setd1a UTSW 7 127785307 unclassified probably benign
FR4548:Setd1a UTSW 7 127785313 unclassified probably benign
FR4589:Setd1a UTSW 7 127785297 unclassified probably benign
FR4737:Setd1a UTSW 7 127785312 unclassified probably benign
FR4976:Setd1a UTSW 7 127785307 unclassified probably benign
FR4976:Setd1a UTSW 7 127785316 unclassified probably benign
R0367:Setd1a UTSW 7 127788186 splice site probably benign
R0411:Setd1a UTSW 7 127796051 unclassified probably benign
R0416:Setd1a UTSW 7 127785297 unclassified probably benign
R0470:Setd1a UTSW 7 127785057 unclassified probably benign
R0645:Setd1a UTSW 7 127787210 missense probably damaging 0.96
R0667:Setd1a UTSW 7 127786593 missense probably damaging 0.99
R1251:Setd1a UTSW 7 127797424 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1465:Setd1a UTSW 7 127788340 unclassified probably benign
R1660:Setd1a UTSW 7 127796669 unclassified probably benign
R1730:Setd1a UTSW 7 127785124 nonsense probably null
R1760:Setd1a UTSW 7 127785890 missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127785124 nonsense probably null
R2149:Setd1a UTSW 7 127786518 missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127785489 missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127799155 unclassified probably benign
R2679:Setd1a UTSW 7 127795724 unclassified probably benign
R3428:Setd1a UTSW 7 127785321 unclassified probably benign
R4108:Setd1a UTSW 7 127799202 unclassified probably benign
R4227:Setd1a UTSW 7 127796647 unclassified probably benign
R4438:Setd1a UTSW 7 127785731 missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127797330 unclassified probably benign
R4869:Setd1a UTSW 7 127797604 unclassified probably benign
R4892:Setd1a UTSW 7 127778524 missense probably damaging 0.99
R5152:Setd1a UTSW 7 127784025 missense probably benign
R5502:Setd1a UTSW 7 127797248 critical splice donor site probably null
R5527:Setd1a UTSW 7 127785629 missense probably damaging 0.99
R6189:Setd1a UTSW 7 127778283 splice site probably null
R6250:Setd1a UTSW 7 127791299 missense unknown
R7131:Setd1a UTSW 7 127796418 small deletion probably benign
R8029:Setd1a UTSW 7 127786214 missense probably benign 0.08
R8079:Setd1a UTSW 7 127785053 missense unknown
R8171:Setd1a UTSW 7 127791227 missense unknown
R8175:Setd1a UTSW 7 127796243 missense unknown
R8286:Setd1a UTSW 7 127786184 missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127791497 missense unknown
R8460:Setd1a UTSW 7 127784120 missense unknown
R8547:Setd1a UTSW 7 127796504 unclassified probably benign
R8699:Setd1a UTSW 7 127786602 missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127786160 missense possibly damaging 0.86
RF001:Setd1a UTSW 7 127785314 unclassified probably benign
RF008:Setd1a UTSW 7 127785314 unclassified probably benign
RF011:Setd1a UTSW 7 127785343 unclassified probably benign
RF014:Setd1a UTSW 7 127785346 unclassified probably benign
RF030:Setd1a UTSW 7 127785301 unclassified probably benign
RF030:Setd1a UTSW 7 127785311 unclassified probably benign
RF031:Setd1a UTSW 7 127785311 unclassified probably benign
RF036:Setd1a UTSW 7 127785300 unclassified probably benign
RF041:Setd1a UTSW 7 127785332 unclassified probably benign
RF052:Setd1a UTSW 7 127785357 unclassified probably benign
RF055:Setd1a UTSW 7 127785299 unclassified probably benign
RF056:Setd1a UTSW 7 127785303 unclassified probably benign
RF056:Setd1a UTSW 7 127785328 unclassified probably benign
RF058:Setd1a UTSW 7 127785318 unclassified probably benign
Z1176:Setd1a UTSW 7 127799094 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCTCTGATGATGACAGGGGTG -3'
(R):5'- GTGTGTACAGAGCATAGGGC -3'

Sequencing Primer
(F):5'- TGATGACAGGGGTGGCTCAC -3'
(R):5'- GCATAGGGCAAGCCATAGG -3'
Posted On2020-09-15