Incidental Mutation 'R7988:Lmntd2'
ID 651594
Institutional Source Beutler Lab
Gene Symbol Lmntd2
Ensembl Gene ENSMUSG00000025500
Gene Name lamin tail domain containing 2
Synonyms 1600016N20Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140789905-140793993 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140793550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Ref Sequence ENSEMBL: ENSMUSP00000130905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000046890] [ENSMUST00000047093] [ENSMUST00000070458] [ENSMUST00000084446] [ENSMUST00000127613] [ENSMUST00000133763] [ENSMUST00000141804] [ENSMUST00000148975] [ENSMUST00000170841] [ENSMUST00000153081] [ENSMUST00000209500] [ENSMUST00000210993]
AlphaFold Q0VET5
Predicted Effect probably damaging
Transcript: ENSMUST00000026573
AA Change: E112G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500
AA Change: E112G

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046890
SMART Domains Protein: ENSMUSP00000038444
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 244 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047093
SMART Domains Protein: ENSMUSP00000048691
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_4 138 177 9.1e-8 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070458
SMART Domains Protein: ENSMUSP00000063912
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 4e-2 PFAM
Pfam:LRR_8 116 171 8.7e-8 PFAM
Pfam:LRR_4 117 158 7.2e-11 PFAM
Pfam:LRR_1 139 159 2.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084446
SMART Domains Protein: ENSMUSP00000081486
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 3.5e-2 PFAM
Pfam:LRR_8 116 171 6.9e-8 PFAM
Pfam:LRR_4 117 158 6.7e-11 PFAM
Pfam:LRR_6 136 160 5.9e-2 PFAM
Pfam:LRR_1 139 159 2.6e-2 PFAM
Pfam:LRR_6 157 182 4.1e-2 PFAM
Pfam:LRR_1 161 199 5.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127613
Predicted Effect probably benign
Transcript: ENSMUST00000133763
SMART Domains Protein: ENSMUSP00000118313
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141804
SMART Domains Protein: ENSMUSP00000115948
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 215 N/A INTRINSIC
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148975
SMART Domains Protein: ENSMUSP00000118078
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
Blast:RA 6 35 5e-13 BLAST
PDB:2CS4|A 7 35 2e-11 PDB
low complexity region 36 47 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170841
AA Change: E112G
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500
AA Change: E112G

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153081
SMART Domains Protein: ENSMUSP00000123128
Gene: ENSMUSG00000038618

DomainStartEndE-ValueType
RA 6 89 1.67e-19 SMART
low complexity region 181 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209500
Predicted Effect probably benign
Transcript: ENSMUST00000210993
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Lmntd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Lmntd2 APN 7 140,793,952 (GRCm39) missense probably damaging 1.00
IGL02444:Lmntd2 APN 7 140,791,832 (GRCm39) missense probably damaging 1.00
IGL02806:Lmntd2 APN 7 140,791,952 (GRCm39) missense probably benign
BB003:Lmntd2 UTSW 7 140,790,258 (GRCm39) missense probably damaging 0.98
BB013:Lmntd2 UTSW 7 140,790,258 (GRCm39) missense probably damaging 0.98
R0117:Lmntd2 UTSW 7 140,790,036 (GRCm39) missense possibly damaging 0.92
R0279:Lmntd2 UTSW 7 140,793,536 (GRCm39) unclassified probably benign
R1686:Lmntd2 UTSW 7 140,790,998 (GRCm39) missense probably damaging 1.00
R1970:Lmntd2 UTSW 7 140,791,972 (GRCm39) unclassified probably benign
R2324:Lmntd2 UTSW 7 140,790,701 (GRCm39) missense possibly damaging 0.62
R3429:Lmntd2 UTSW 7 140,793,910 (GRCm39) missense probably benign 0.05
R3928:Lmntd2 UTSW 7 140,791,117 (GRCm39) missense probably damaging 0.97
R4883:Lmntd2 UTSW 7 140,792,531 (GRCm39) missense probably damaging 1.00
R4985:Lmntd2 UTSW 7 140,793,190 (GRCm39) missense probably benign 0.00
R5219:Lmntd2 UTSW 7 140,791,387 (GRCm39) splice site probably null
R7172:Lmntd2 UTSW 7 140,793,554 (GRCm39) missense unknown
R7475:Lmntd2 UTSW 7 140,790,602 (GRCm39) critical splice donor site probably null
R7847:Lmntd2 UTSW 7 140,790,063 (GRCm39) missense probably benign 0.07
R7926:Lmntd2 UTSW 7 140,790,258 (GRCm39) missense probably damaging 0.98
R8198:Lmntd2 UTSW 7 140,791,134 (GRCm39) missense possibly damaging 0.95
R8487:Lmntd2 UTSW 7 140,790,427 (GRCm39) missense probably benign
R8707:Lmntd2 UTSW 7 140,791,234 (GRCm39) nonsense probably null
R8814:Lmntd2 UTSW 7 140,789,997 (GRCm39) missense probably damaging 1.00
R8988:Lmntd2 UTSW 7 140,791,977 (GRCm39) unclassified probably benign
R9563:Lmntd2 UTSW 7 140,790,701 (GRCm39) missense
R9564:Lmntd2 UTSW 7 140,790,701 (GRCm39) missense
R9577:Lmntd2 UTSW 7 140,790,990 (GRCm39) missense probably benign 0.29
R9796:Lmntd2 UTSW 7 140,793,597 (GRCm39) missense possibly damaging 0.68
X0027:Lmntd2 UTSW 7 140,790,963 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTAAACCCTAACAGGTCTGGGC -3'
(R):5'- ACCACAGGGCTCTGAAATTG -3'

Sequencing Primer
(F):5'- TAGGATGACATTTCCAGCACAG -3'
(R):5'- TGAAATTGCAGGTTAGCCCC -3'
Posted On 2020-09-15