Incidental Mutation 'R7988:Htra4'
ID 651595
Institutional Source Beutler Lab
Gene Symbol Htra4
Ensembl Gene ENSMUSG00000037406
Gene Name HtrA serine peptidase 4
Synonyms B430206E18Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 25514945-25528978 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 25520526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084031]
AlphaFold A2RT60
Predicted Effect probably null
Transcript: ENSMUST00000084031
SMART Domains Protein: ENSMUSP00000081044
Gene: ENSMUSG00000037406

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IB 37 112 5.44e-7 SMART
KAZAL 109 158 7.92e-4 SMART
Pfam:Trypsin 182 368 5.5e-15 PFAM
Pfam:Trypsin_2 208 346 2.1e-34 PFAM
PDZ 385 470 5.34e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HtrA family of proteases. The encoded protein contains a putative signal peptide, an insulin growth factor binding domain, a Kazal protease inhibitor domain, a conserved trypsin domain and a PDZ domain. Based on studies on other related family members, this enzyme may function as a secreted oligomeric chaperone protease to degrade misfolded secretory proteins. Other human HtrA proteins have been implicated in arthritis, tumor suppression, unfolded stress response, apoptosis, and aging. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Htra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Htra4 APN 8 25,523,587 (GRCm39) missense probably damaging 0.98
IGL01738:Htra4 APN 8 25,515,727 (GRCm39) missense probably damaging 0.96
IGL02307:Htra4 APN 8 25,523,710 (GRCm39) missense probably damaging 1.00
IGL03382:Htra4 APN 8 25,519,714 (GRCm39) missense probably benign 0.17
R0057:Htra4 UTSW 8 25,528,824 (GRCm39) missense probably benign
R0906:Htra4 UTSW 8 25,527,160 (GRCm39) missense probably benign 0.00
R1075:Htra4 UTSW 8 25,523,612 (GRCm39) missense probably benign 0.00
R1173:Htra4 UTSW 8 25,520,635 (GRCm39) missense possibly damaging 0.92
R1180:Htra4 UTSW 8 25,523,735 (GRCm39) missense probably damaging 1.00
R1854:Htra4 UTSW 8 25,523,597 (GRCm39) missense probably damaging 1.00
R2030:Htra4 UTSW 8 25,523,593 (GRCm39) missense probably damaging 1.00
R2225:Htra4 UTSW 8 25,515,736 (GRCm39) missense probably benign 0.42
R4457:Htra4 UTSW 8 25,528,674 (GRCm39) missense possibly damaging 0.90
R4626:Htra4 UTSW 8 25,527,130 (GRCm39) missense probably benign 0.29
R4746:Htra4 UTSW 8 25,523,713 (GRCm39) missense probably damaging 1.00
R4797:Htra4 UTSW 8 25,523,675 (GRCm39) missense probably damaging 1.00
R5369:Htra4 UTSW 8 25,523,585 (GRCm39) missense possibly damaging 0.95
R6846:Htra4 UTSW 8 25,520,561 (GRCm39) missense probably damaging 1.00
R6911:Htra4 UTSW 8 25,515,721 (GRCm39) missense probably damaging 0.96
R7067:Htra4 UTSW 8 25,523,717 (GRCm39) missense probably damaging 1.00
R7367:Htra4 UTSW 8 25,523,713 (GRCm39) missense probably damaging 1.00
R7446:Htra4 UTSW 8 25,527,181 (GRCm39) missense probably benign 0.09
R7603:Htra4 UTSW 8 25,515,716 (GRCm39) missense probably benign 0.03
R7725:Htra4 UTSW 8 25,527,169 (GRCm39) missense possibly damaging 0.94
R7729:Htra4 UTSW 8 25,527,093 (GRCm39) missense possibly damaging 0.63
R7893:Htra4 UTSW 8 25,523,695 (GRCm39) missense possibly damaging 0.81
R8140:Htra4 UTSW 8 25,520,574 (GRCm39) missense possibly damaging 0.75
R9169:Htra4 UTSW 8 25,520,133 (GRCm39) missense probably damaging 1.00
R9223:Htra4 UTSW 8 25,527,048 (GRCm39) missense possibly damaging 0.94
R9229:Htra4 UTSW 8 25,528,557 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACAACACAAGCATTTCTGC -3'
(R):5'- AAGTGGGTCTCCTTTTGCCC -3'

Sequencing Primer
(F):5'- TCTGCGTATCTCTCAGATTGAG -3'
(R):5'- GTCCCCATGTTGCGTGG -3'
Posted On 2020-09-15