Incidental Mutation 'R7988:Hook3'
ID 651596
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Name hook microtubule tethering protein 3
Synonyms E330005F07Rik, 5830454D03Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 26511449-26609252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26563675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 190 (S190T)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
AlphaFold Q8BUK6
Predicted Effect probably benign
Transcript: ENSMUST00000037182
AA Change: S190T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: S190T

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26,549,278 (GRCm39) missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26,538,326 (GRCm39) missense probably damaging 1.00
IGL01145:Hook3 APN 8 26,549,372 (GRCm39) missense probably benign 0.00
IGL01514:Hook3 APN 8 26,578,217 (GRCm39) missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26,560,187 (GRCm39) missense probably benign 0.00
IGL01832:Hook3 APN 8 26,562,393 (GRCm39) missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26,529,760 (GRCm39) missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26,578,083 (GRCm39) splice site probably benign
IGL01948:Hook3 APN 8 26,549,340 (GRCm39) missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26,560,293 (GRCm39) missense probably damaging 0.99
IGL02675:Hook3 APN 8 26,551,462 (GRCm39) missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26,585,782 (GRCm39) splice site probably benign
Rufio UTSW 8 26,524,968 (GRCm39) nonsense probably null
R0384:Hook3 UTSW 8 26,534,263 (GRCm39) splice site probably null
R0600:Hook3 UTSW 8 26,609,014 (GRCm39) missense probably benign
R1037:Hook3 UTSW 8 26,562,378 (GRCm39) missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26,528,134 (GRCm39) missense probably damaging 0.98
R1563:Hook3 UTSW 8 26,600,780 (GRCm39) missense probably benign 0.06
R1767:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R1806:Hook3 UTSW 8 26,558,687 (GRCm39) missense probably damaging 1.00
R2025:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2026:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2027:Hook3 UTSW 8 26,528,126 (GRCm39) missense probably damaging 0.96
R2091:Hook3 UTSW 8 26,549,422 (GRCm39) splice site probably benign
R2153:Hook3 UTSW 8 26,560,225 (GRCm39) missense probably damaging 1.00
R2184:Hook3 UTSW 8 26,609,011 (GRCm39) missense probably benign 0.00
R4586:Hook3 UTSW 8 26,522,039 (GRCm39) missense probably damaging 0.98
R4863:Hook3 UTSW 8 26,528,057 (GRCm39) missense probably damaging 1.00
R4971:Hook3 UTSW 8 26,572,607 (GRCm39) missense probably benign 0.22
R5023:Hook3 UTSW 8 26,522,047 (GRCm39) frame shift probably null
R5026:Hook3 UTSW 8 26,600,785 (GRCm39) missense probably damaging 0.98
R5068:Hook3 UTSW 8 26,585,785 (GRCm39) critical splice donor site probably null
R5253:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
R5383:Hook3 UTSW 8 26,609,017 (GRCm39) missense probably benign 0.01
R5437:Hook3 UTSW 8 26,551,450 (GRCm39) missense probably benign 0.05
R5528:Hook3 UTSW 8 26,562,321 (GRCm39) missense probably damaging 1.00
R5551:Hook3 UTSW 8 26,558,639 (GRCm39) missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26,534,355 (GRCm39) intron probably benign
R5907:Hook3 UTSW 8 26,534,306 (GRCm39) intron probably benign
R6082:Hook3 UTSW 8 26,600,813 (GRCm39) missense probably benign 0.00
R6124:Hook3 UTSW 8 26,549,300 (GRCm39) missense probably benign 0.20
R6301:Hook3 UTSW 8 26,524,968 (GRCm39) nonsense probably null
R6314:Hook3 UTSW 8 26,578,136 (GRCm39) missense probably benign
R6448:Hook3 UTSW 8 26,583,692 (GRCm39) missense probably benign 0.02
R6810:Hook3 UTSW 8 26,522,450 (GRCm39) splice site probably null
R7168:Hook3 UTSW 8 26,561,114 (GRCm39) missense probably benign 0.02
R7856:Hook3 UTSW 8 26,525,249 (GRCm39) missense probably damaging 1.00
R8079:Hook3 UTSW 8 26,578,086 (GRCm39) critical splice donor site probably null
R9121:Hook3 UTSW 8 26,525,195 (GRCm39) missense probably damaging 1.00
R9223:Hook3 UTSW 8 26,522,552 (GRCm39) missense
R9244:Hook3 UTSW 8 26,561,084 (GRCm39) critical splice donor site probably null
R9246:Hook3 UTSW 8 26,562,319 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTAAATTACAGAGAGCACACTCCTC -3'
(R):5'- CATGGGCAGAAATCTTTGTGTC -3'

Sequencing Primer
(F):5'- CTAAATCAGAACCCTATTTGCTCTG -3'
(R):5'- GACTCTGTCTCAACAAAAAGCTG -3'
Posted On 2020-09-15