Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Hook3'

651596

Institutional Source

Beutler Lab

Gene Symbol

Hook3

Ensembl Gene

ENSMUSG00000037234

Gene Name

hook microtubule tethering protein 3

Synonyms

E330005F07Rik, 5830454D03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26021421-26119224 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26073647 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 190 (S190T)

Ref Sequence

ENSEMBL: ENSMUSP00000046788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]

AlphaFold

Q8BUK6

Predicted Effect

probably benign
Transcript: ENSMUST00000037182
AA Change: S190T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: S190T

Domain	Start	End	E-Value	Type
Pfam:HOOK	12	710	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147613

SMART Domains

Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

Domain	Start	End	E-Value	Type
Pfam:HOOK	1	194	1.1e-75	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Hook3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00695:Hook3	APN	8	26059250	missense	possibly damaging	0.46
IGL01066:Hook3	APN	8	26048298	missense	probably damaging	1.00
IGL01145:Hook3	APN	8	26059344	missense	probably benign	0.00
IGL01514:Hook3	APN	8	26088189	missense	possibly damaging	0.69
IGL01727:Hook3	APN	8	26070159	missense	probably benign	0.00
IGL01832:Hook3	APN	8	26072365	missense	possibly damaging	0.87
IGL01874:Hook3	APN	8	26039732	missense	possibly damaging	0.71
IGL01931:Hook3	APN	8	26088055	splice site	probably benign
IGL01948:Hook3	APN	8	26059312	missense	possibly damaging	0.95
IGL02209:Hook3	APN	8	26070265	missense	probably damaging	0.99
IGL02675:Hook3	APN	8	26061434	missense	possibly damaging	0.64
IGL02750:Hook3	APN	8	26095754	splice site	probably benign
Rufio	UTSW	8	26034940	nonsense	probably null
R0384:Hook3	UTSW	8	26044235	splice site	probably null
R0600:Hook3	UTSW	8	26118986	missense	probably benign
R1037:Hook3	UTSW	8	26072350	missense	possibly damaging	0.92
R1413:Hook3	UTSW	8	26038106	missense	probably damaging	0.98
R1563:Hook3	UTSW	8	26110752	missense	probably benign	0.06
R1767:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R1806:Hook3	UTSW	8	26068659	missense	probably damaging	1.00
R2025:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2026:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2027:Hook3	UTSW	8	26038098	missense	probably damaging	0.96
R2091:Hook3	UTSW	8	26059394	splice site	probably benign
R2153:Hook3	UTSW	8	26070197	missense	probably damaging	1.00
R2184:Hook3	UTSW	8	26118983	missense	probably benign	0.00
R4586:Hook3	UTSW	8	26032011	missense	probably damaging	0.98
R4863:Hook3	UTSW	8	26038029	missense	probably damaging	1.00
R4971:Hook3	UTSW	8	26082579	missense	probably benign	0.22
R5023:Hook3	UTSW	8	26032019	frame shift	probably null
R5026:Hook3	UTSW	8	26110757	missense	probably damaging	0.98
R5068:Hook3	UTSW	8	26095757	critical splice donor site	probably null
R5253:Hook3	UTSW	8	26072291	missense	probably benign
R5383:Hook3	UTSW	8	26118989	missense	probably benign	0.01
R5437:Hook3	UTSW	8	26061422	missense	probably benign	0.05
R5528:Hook3	UTSW	8	26072293	missense	probably damaging	1.00
R5551:Hook3	UTSW	8	26068611	missense	possibly damaging	0.75
R5846:Hook3	UTSW	8	26044327	intron	probably benign
R5907:Hook3	UTSW	8	26044278	intron	probably benign
R6082:Hook3	UTSW	8	26110785	missense	probably benign	0.00
R6124:Hook3	UTSW	8	26059272	missense	probably benign	0.20
R6301:Hook3	UTSW	8	26034940	nonsense	probably null
R6314:Hook3	UTSW	8	26088108	missense	probably benign
R6448:Hook3	UTSW	8	26093664	missense	probably benign	0.02
R6810:Hook3	UTSW	8	26032422	splice site	probably null
R7168:Hook3	UTSW	8	26071086	missense	probably benign	0.02
R7856:Hook3	UTSW	8	26035221	missense	probably damaging	1.00
R8079:Hook3	UTSW	8	26088058	critical splice donor site	probably null
R9121:Hook3	UTSW	8	26035167	missense	probably damaging	1.00
R9223:Hook3	UTSW	8	26032524	missense
R9244:Hook3	UTSW	8	26071056	critical splice donor site	probably null
R9246:Hook3	UTSW	8	26072291	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTAAATTACAGAGAGCACACTCCTC -3'
(R):5'- CATGGGCAGAAATCTTTGTGTC -3'

Sequencing Primer
(F):5'- CTAAATCAGAACCCTATTTGCTCTG -3'
(R):5'- GACTCTGTCTCAACAAAAAGCTG -3'

Posted On

2020-09-15