Incidental Mutation 'R7988:Hook3'
ID651596
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Namehook microtubule tethering protein 3
SynonymsE330005F07Rik, 5830454D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location26021421-26119224 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26073647 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 190 (S190T)
Ref Sequence ENSEMBL: ENSMUSP00000046788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
Predicted Effect probably benign
Transcript: ENSMUST00000037182
AA Change: S190T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: S190T

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147613
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R1806:Hook3 UTSW 8 26068659 missense probably damaging 1.00
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
R7168:Hook3 UTSW 8 26071086 missense probably benign 0.02
R7856:Hook3 UTSW 8 26035221 missense probably damaging 1.00
R8079:Hook3 UTSW 8 26088058 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTAAATTACAGAGAGCACACTCCTC -3'
(R):5'- CATGGGCAGAAATCTTTGTGTC -3'

Sequencing Primer
(F):5'- CTAAATCAGAACCCTATTTGCTCTG -3'
(R):5'- GACTCTGTCTCAACAAAAAGCTG -3'
Posted On2020-09-15