Incidental Mutation 'R7988:Usp38'
ID651597
Institutional Source Beutler Lab
Gene Symbol Usp38
Ensembl Gene ENSMUSG00000038250
Gene Nameubiquitin specific peptidase 38
Synonyms4833420O05Rik, 4631402N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80980733-81014928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81014316 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 41 (M41L)
Ref Sequence ENSEMBL: ENSMUSP00000039943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042724]
Predicted Effect probably benign
Transcript: ENSMUST00000042724
AA Change: M41L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039943
Gene: ENSMUSG00000038250
AA Change: M41L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 1 365 5e-3 SMART
Pfam:UCH 444 946 1.8e-47 PFAM
Pfam:UCH_1 445 921 2.2e-23 PFAM
low complexity region 995 1006 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Usp38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Usp38 APN 8 81013840 missense probably damaging 0.99
IGL01373:Usp38 APN 8 80990018 missense possibly damaging 0.80
IGL02089:Usp38 APN 8 80985714 missense possibly damaging 0.48
IGL02528:Usp38 APN 8 80993235 missense probably damaging 1.00
IGL02538:Usp38 APN 8 80985558 missense probably damaging 1.00
IGL02615:Usp38 APN 8 80985151 missense probably benign 0.00
IGL03340:Usp38 APN 8 81012276 missense probably damaging 1.00
P0033:Usp38 UTSW 8 80981896 missense probably benign 0.12
R0313:Usp38 UTSW 8 80984442 nonsense probably null
R0331:Usp38 UTSW 8 80995840 missense probably benign 0.00
R0497:Usp38 UTSW 8 80984424 splice site probably benign
R0594:Usp38 UTSW 8 81005366 missense probably damaging 0.97
R0632:Usp38 UTSW 8 81014150 missense probably benign 0.03
R1355:Usp38 UTSW 8 80985033 missense possibly damaging 0.61
R1500:Usp38 UTSW 8 80995770 missense probably damaging 1.00
R1566:Usp38 UTSW 8 80984803 missense probably benign 0.00
R1880:Usp38 UTSW 8 81001066 missense probably damaging 1.00
R4161:Usp38 UTSW 8 80993338 missense probably damaging 1.00
R4176:Usp38 UTSW 8 80993299 missense probably benign 0.33
R4882:Usp38 UTSW 8 80981977 nonsense probably null
R5344:Usp38 UTSW 8 80985763 missense possibly damaging 0.76
R5481:Usp38 UTSW 8 80993323 missense possibly damaging 0.89
R5564:Usp38 UTSW 8 80985088 missense probably damaging 0.96
R5897:Usp38 UTSW 8 81005453 missense probably benign 0.03
R6111:Usp38 UTSW 8 81013922 missense probably damaging 1.00
R6746:Usp38 UTSW 8 81014291 missense possibly damaging 0.80
R6912:Usp38 UTSW 8 80993329 missense probably damaging 1.00
R7051:Usp38 UTSW 8 81001121 missense possibly damaging 0.50
R7483:Usp38 UTSW 8 81014561 start gained probably benign
R7525:Usp38 UTSW 8 81014246 missense probably damaging 1.00
R7565:Usp38 UTSW 8 80981972 missense probably damaging 1.00
R7915:Usp38 UTSW 8 81001083 missense probably damaging 1.00
R7934:Usp38 UTSW 8 80984448 missense probably damaging 1.00
R8062:Usp38 UTSW 8 80984589 missense probably damaging 1.00
R8340:Usp38 UTSW 8 80985402 missense probably benign
R8514:Usp38 UTSW 8 80985717 missense probably benign 0.01
R8919:Usp38 UTSW 8 80981850 missense probably damaging 1.00
RF016:Usp38 UTSW 8 81013893 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAATGTAGTCCAGGATGGCGAC -3'
(R):5'- TGGTTGGCTCCAAGTTCCTC -3'

Sequencing Primer
(F):5'- ATGGCGACGTCCTTCCTG -3'
(R):5'- AAGTTCCTCCCCGCCGG -3'
Posted On2020-09-15