Incidental Mutation 'R7988:Cmtm1'
ID651598
Institutional Source Beutler Lab
Gene Symbol Cmtm1
Ensembl Gene ENSMUSG00000110430
Gene NameCKLF-like MARVEL transmembrane domain containing 1
SynonymsCklfsf1, CHLFH1a, CKLFH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7988 (G1)
Quality Score111.008
Status Validated
Chromosome8
Chromosomal Location104292622-104310145 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 104310142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159039] [ENSMUST00000160596] [ENSMUST00000162616] [ENSMUST00000164175]
Predicted Effect probably benign
Transcript: ENSMUST00000159039
SMART Domains Protein: ENSMUSP00000124855
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 7.45e-12 PROSPERO
internal_repeat_2 34 74 9.92e-7 PROSPERO
internal_repeat_1 66 103 7.45e-12 PROSPERO
internal_repeat_2 122 162 9.92e-7 PROSPERO
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160596
SMART Domains Protein: ENSMUSP00000124656
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162616
SMART Domains Protein: ENSMUSP00000124800
Gene: ENSMUSG00000031876

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 33 70 1.42e-11 PROSPERO
internal_repeat_2 34 74 1.79e-6 PROSPERO
internal_repeat_1 66 103 1.42e-11 PROSPERO
internal_repeat_2 122 162 1.79e-6 PROSPERO
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 315 334 N/A INTRINSIC
transmembrane domain 341 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164175
SMART Domains Protein: ENSMUSP00000132828
Gene: ENSMUSG00000110430

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
internal_repeat_1 34 71 1.23e-5 PROSPERO
internal_repeat_1 100 137 1.23e-5 PROSPERO
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Cmtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Senilicus UTSW 8 104309295 missense possibly damaging 0.90
G1citation:Cmtm1 UTSW 8 104309702 frame shift probably null
R2900:Cmtm1 UTSW 8 104309544 missense possibly damaging 0.95
R4132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4615:Cmtm1 UTSW 8 104309470 small deletion probably benign
R4723:Cmtm1 UTSW 8 104293675 missense probably damaging 0.96
R5277:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5347:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5364:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5394:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5403:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5611:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5715:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5731:Cmtm1 UTSW 8 104309470 small deletion probably benign
R5773:Cmtm1 UTSW 8 104305176 missense probably damaging 1.00
R6017:Cmtm1 UTSW 8 104310951 unclassified probably benign
R6207:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6313:Cmtm1 UTSW 8 104305163 missense possibly damaging 0.81
R6528:Cmtm1 UTSW 8 104309295 missense possibly damaging 0.90
R6817:Cmtm1 UTSW 8 104309470 small deletion probably benign
R6821:Cmtm1 UTSW 8 104309702 frame shift probably null
R6822:Cmtm1 UTSW 8 104309702 frame shift probably null
R7028:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7128:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7132:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7816:Cmtm1 UTSW 8 104309470 small deletion probably benign
R7819:Cmtm1 UTSW 8 104309702 frame shift probably null
R7841:Cmtm1 UTSW 8 104309476 missense possibly damaging 0.55
R7963:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8130:Cmtm1 UTSW 8 104309456 missense unknown
R8152:Cmtm1 UTSW 8 104309941 missense possibly damaging 0.83
R8439:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8459:Cmtm1 UTSW 8 104309511 missense possibly damaging 0.95
R8683:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8771:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8843:Cmtm1 UTSW 8 104309702 frame shift probably null
R8860:Cmtm1 UTSW 8 104309702 frame shift probably null
R8871:Cmtm1 UTSW 8 104309702 frame shift probably null
R8886:Cmtm1 UTSW 8 104309470 small deletion probably benign
R8957:Cmtm1 UTSW 8 104309470 small deletion probably benign
RF041:Cmtm1 UTSW 8 104309470 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTCGTAAAGTTAAGCGTCTGG -3'
(R):5'- GCCTCACTGCATATGGCTTG -3'

Sequencing Primer
(F):5'- AGTTAAGCGTCTGGACTCAC -3'
(R):5'- CATATGGCTTGGGGCTGGAATC -3'
Posted On2020-09-15