Incidental Mutation 'R7988:Klhl18'
ID651602
Institutional Source Beutler Lab
Gene Symbol Klhl18
Ensembl Gene ENSMUSG00000054792
Gene Namekelch-like 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110425926-110476694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110476509 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 29 (E29V)
Ref Sequence ENSEMBL: ENSMUSP00000143634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000068025] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043] [ENSMUST00000198164] [ENSMUST00000198858]
Predicted Effect probably benign
Transcript: ENSMUST00000061155
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068025
AA Change: E29V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: E29V

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084952
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197248
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198164
AA Change: E29V

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: E29V

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198858
SMART Domains Protein: ENSMUSP00000142888
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 9 144 6.7e-7 SMART
Meta Mutation Damage Score 0.2923 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Klhl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Klhl18 APN 9 110428686 missense probably damaging 1.00
IGL01338:Klhl18 APN 9 110455433 missense probably damaging 1.00
IGL01455:Klhl18 APN 9 110432443 missense probably damaging 1.00
IGL01954:Klhl18 APN 9 110428866 missense probably damaging 1.00
IGL01960:Klhl18 APN 9 110450746 missense probably benign 0.25
IGL02195:Klhl18 APN 9 110438902 missense possibly damaging 0.92
IGL02430:Klhl18 APN 9 110437401 missense probably benign 0.25
IGL02629:Klhl18 APN 9 110429938 splice site probably benign
Mixie UTSW 9 110436062 missense probably benign 0.00
R0389:Klhl18 UTSW 9 110428681 missense probably benign 0.00
R1538:Klhl18 UTSW 9 110446747 missense probably damaging 1.00
R1777:Klhl18 UTSW 9 110437401 missense probably benign 0.25
R1966:Klhl18 UTSW 9 110476590 missense probably benign 0.14
R2099:Klhl18 UTSW 9 110455418 missense probably damaging 1.00
R3699:Klhl18 UTSW 9 110436066 missense probably benign 0.06
R3911:Klhl18 UTSW 9 110436083 missense probably damaging 1.00
R3950:Klhl18 UTSW 9 110428902 missense probably damaging 1.00
R4197:Klhl18 UTSW 9 110429944 critical splice donor site probably null
R4500:Klhl18 UTSW 9 110429966 missense probably damaging 1.00
R4936:Klhl18 UTSW 9 110428961 missense possibly damaging 0.88
R5296:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5298:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5301:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5407:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5433:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5641:Klhl18 UTSW 9 110446828 missense probably damaging 1.00
R6084:Klhl18 UTSW 9 110428727 missense possibly damaging 0.52
R6279:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6300:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6425:Klhl18 UTSW 9 110446681 missense possibly damaging 0.85
R6465:Klhl18 UTSW 9 110428920 missense probably benign 0.21
R6521:Klhl18 UTSW 9 110428635 missense possibly damaging 0.92
R6587:Klhl18 UTSW 9 110455426 missense probably damaging 1.00
R6730:Klhl18 UTSW 9 110428911 missense probably damaging 0.98
R7110:Klhl18 UTSW 9 110450765 missense probably damaging 0.99
R7492:Klhl18 UTSW 9 110428775 nonsense probably null
R7580:Klhl18 UTSW 9 110436050 missense probably benign 0.00
R7598:Klhl18 UTSW 9 110446810 nonsense probably null
R7789:Klhl18 UTSW 9 110439008 missense unknown
R8050:Klhl18 UTSW 9 110428761 missense probably damaging 1.00
Z1176:Klhl18 UTSW 9 110437347 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TGAACGGCTGTCCCCTTTAC -3'
(R):5'- CGAAGCCTGAGTTTGAGTTACG -3'

Sequencing Primer
(F):5'- GGCACCGCTCTCTACTACTCTG -3'
(R):5'- AGTGAGATTCCGGCTTCGC -3'
Posted On2020-09-15