Incidental Mutation 'R7988:Cfap54'
ID651606
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92902079 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2319 (D2319V)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
Predicted Effect probably benign
Transcript: ENSMUST00000067705
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: D2254V
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: D2254V

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212902
AA Change: D2319V
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 splice site probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7844:Cfap54 UTSW 10 92902058 missense unknown
R7980:Cfap54 UTSW 10 92982060 missense possibly damaging 0.95
R8101:Cfap54 UTSW 10 92884796 missense unknown
R8119:Cfap54 UTSW 10 92868810 missense unknown
R8134:Cfap54 UTSW 10 92878516 missense unknown
R8168:Cfap54 UTSW 10 92908877 missense unknown
R8179:Cfap54 UTSW 10 92997316 missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92962417 missense unknown
R8436:Cfap54 UTSW 10 92964536 missense unknown
R8505:Cfap54 UTSW 10 92978993 missense probably benign 0.03
R8671:Cfap54 UTSW 10 92955072 missense unknown
R8716:Cfap54 UTSW 10 92964632 missense probably benign 0.00
R8816:Cfap54 UTSW 10 92878592 missense unknown
R8822:Cfap54 UTSW 10 93039141 missense probably benign 0.09
R8827:Cfap54 UTSW 10 92938248 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTGTGAGAATTAAACCAGC -3'
(R):5'- AGTAACATCATTCAGCATGCAAAGG -3'

Sequencing Primer
(F):5'- CATGCAAAATGGCTGCTGTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2020-09-15