Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:Otogl'

651607

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 107895776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 168 (C168Y)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

AlphaFold

F7A4A7

Predicted Effect

probably damaging
Transcript: ENSMUST00000165341
AA Change: C168Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: C168Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.7683

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
2010111I01Rik	A	G	13: 63,061,140	D357G	probably benign	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	probably null
R9025:Otogl	UTSW	10	107777571	missense	probably damaging	0.99
R9090:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9223:Otogl	UTSW	10	107854344	missense	probably damaging	0.99
R9268:Otogl	UTSW	10	107781056	missense	probably damaging	1.00
R9271:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9356:Otogl	UTSW	10	107782029	missense	probably damaging	1.00
R9484:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R9484:Otogl	UTSW	10	107901295	missense	probably damaging	1.00
R9571:Otogl	UTSW	10	107762503	missense	possibly damaging	0.94
R9731:Otogl	UTSW	10	107899467	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CCTGTAAAAGTCAGCTGAAGAAC -3'
(R):5'- GGATCCCTGCAGTTATTTCTCATG -3'

Sequencing Primer
(F):5'- GTCAGCTGAAGAACAAGTCCTCTC -3'
(R):5'- CCTCCCTCCCTCCCACC -3'

Posted On

2020-09-15