Incidental Mutation 'R7988:Osbpl8'
ID651608
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Nameoxysterol binding protein-like 8
SynonymsD330025H14Rik, ORP-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location111164752-111297249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111272080 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 312 (N312K)
Ref Sequence ENSEMBL: ENSMUSP00000100911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095310
AA Change: N270K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: N270K

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105275
AA Change: N312K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: N312K

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111273044 missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111272320 splice site probably benign
IGL00839:Osbpl8 APN 10 111291510 missense probably benign 0.01
IGL01148:Osbpl8 APN 10 111276563 splice site probably benign
IGL01338:Osbpl8 APN 10 111267747 missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111270616 missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111282145 missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111284425 splice site probably benign
IGL02933:Osbpl8 APN 10 111282130 missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111291556 missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111272282 missense probably benign
R0725:Osbpl8 UTSW 10 111286240 missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111276479 missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111291581 missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111275049 missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111289811 missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2849:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R3693:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111289790 missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4377:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111269418 missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111291496 missense probably benign 0.00
R4851:Osbpl8 UTSW 10 111204800 start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111288693 missense probably benign 0.28
R5179:Osbpl8 UTSW 10 111272164 missense probably benign 0.01
R5309:Osbpl8 UTSW 10 111270557 missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111272168 missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111267783 nonsense probably null
R6293:Osbpl8 UTSW 10 111272238 missense possibly damaging 0.96
R6362:Osbpl8 UTSW 10 111273068 nonsense probably null
R6527:Osbpl8 UTSW 10 111293205 missense probably benign 0.23
R6751:Osbpl8 UTSW 10 111275013 missense possibly damaging 0.67
R6851:Osbpl8 UTSW 10 111270618 nonsense probably null
R6955:Osbpl8 UTSW 10 111269444 critical splice donor site probably null
R7224:Osbpl8 UTSW 10 111275011 missense possibly damaging 0.94
R7235:Osbpl8 UTSW 10 111269427 missense probably benign
R7685:Osbpl8 UTSW 10 111276509 nonsense probably null
R8055:Osbpl8 UTSW 10 111284394 missense possibly damaging 0.68
R8458:Osbpl8 UTSW 10 111277316 missense possibly damaging 0.81
R8777:Osbpl8 UTSW 10 111293113 missense probably benign 0.01
R8777-TAIL:Osbpl8 UTSW 10 111293113 missense probably benign 0.01
R8844:Osbpl8 UTSW 10 111276475 missense probably damaging 1.00
R8948:Osbpl8 UTSW 10 111267669 missense probably damaging 0.97
R8954:Osbpl8 UTSW 10 111272192 missense probably benign 0.02
RF007:Osbpl8 UTSW 10 111276467 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTCCACTGCTCTGTAAGGG -3'
(R):5'- TGCTCCATGTAGGTGGTCTC -3'

Sequencing Primer
(F):5'- TCCACTGCTCTGTAAGGGAAGTC -3'
(R):5'- TTTAAGGGCTCCACAGGCTCAG -3'
Posted On2020-09-15