Incidental Mutation 'R7988:Osbpl8'
ID 651608
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Name oxysterol binding protein-like 8
Synonyms ORP-8, D330025H14Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 111000663-111133110 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 111107941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 312 (N312K)
Ref Sequence ENSEMBL: ENSMUSP00000100911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
AlphaFold B9EJ86
Predicted Effect possibly damaging
Transcript: ENSMUST00000095310
AA Change: N270K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: N270K

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105275
AA Change: N312K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: N312K

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111,108,905 (GRCm39) missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111,108,181 (GRCm39) splice site probably benign
IGL00839:Osbpl8 APN 10 111,127,371 (GRCm39) missense probably benign 0.01
IGL01148:Osbpl8 APN 10 111,112,424 (GRCm39) splice site probably benign
IGL01338:Osbpl8 APN 10 111,103,608 (GRCm39) missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111,106,477 (GRCm39) missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111,118,006 (GRCm39) missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111,120,286 (GRCm39) splice site probably benign
IGL02933:Osbpl8 APN 10 111,117,991 (GRCm39) missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111,127,417 (GRCm39) missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111,108,143 (GRCm39) missense probably benign
R0725:Osbpl8 UTSW 10 111,122,101 (GRCm39) missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111,112,340 (GRCm39) missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111,127,442 (GRCm39) missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111,110,910 (GRCm39) missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111,125,672 (GRCm39) missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111,105,297 (GRCm39) missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111,105,297 (GRCm39) missense probably benign 0.27
R2849:Osbpl8 UTSW 10 111,105,297 (GRCm39) missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111,105,297 (GRCm39) missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111,105,297 (GRCm39) missense probably benign 0.27
R3693:Osbpl8 UTSW 10 111,105,297 (GRCm39) missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111,125,651 (GRCm39) missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111,105,280 (GRCm39) missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111,105,280 (GRCm39) missense possibly damaging 0.93
R4377:Osbpl8 UTSW 10 111,105,280 (GRCm39) missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111,105,279 (GRCm39) missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111,127,357 (GRCm39) missense probably benign 0.00
R4851:Osbpl8 UTSW 10 111,040,661 (GRCm39) start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111,124,554 (GRCm39) missense probably benign 0.28
R5179:Osbpl8 UTSW 10 111,108,025 (GRCm39) missense probably benign 0.01
R5309:Osbpl8 UTSW 10 111,106,418 (GRCm39) missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111,108,029 (GRCm39) missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111,103,644 (GRCm39) nonsense probably null
R6293:Osbpl8 UTSW 10 111,108,099 (GRCm39) missense possibly damaging 0.96
R6362:Osbpl8 UTSW 10 111,108,929 (GRCm39) nonsense probably null
R6527:Osbpl8 UTSW 10 111,129,066 (GRCm39) missense probably benign 0.23
R6751:Osbpl8 UTSW 10 111,110,874 (GRCm39) missense possibly damaging 0.67
R6851:Osbpl8 UTSW 10 111,106,479 (GRCm39) nonsense probably null
R6955:Osbpl8 UTSW 10 111,105,305 (GRCm39) critical splice donor site probably null
R7224:Osbpl8 UTSW 10 111,110,872 (GRCm39) missense possibly damaging 0.94
R7235:Osbpl8 UTSW 10 111,105,288 (GRCm39) missense probably benign
R7685:Osbpl8 UTSW 10 111,112,370 (GRCm39) nonsense probably null
R8055:Osbpl8 UTSW 10 111,120,255 (GRCm39) missense possibly damaging 0.68
R8458:Osbpl8 UTSW 10 111,113,177 (GRCm39) missense possibly damaging 0.81
R8777:Osbpl8 UTSW 10 111,128,974 (GRCm39) missense probably benign 0.01
R8777-TAIL:Osbpl8 UTSW 10 111,128,974 (GRCm39) missense probably benign 0.01
R8844:Osbpl8 UTSW 10 111,112,336 (GRCm39) missense probably damaging 1.00
R8948:Osbpl8 UTSW 10 111,103,530 (GRCm39) missense probably damaging 0.97
R8954:Osbpl8 UTSW 10 111,108,053 (GRCm39) missense probably benign 0.02
R8997:Osbpl8 UTSW 10 111,091,575 (GRCm39) missense probably benign 0.01
R9236:Osbpl8 UTSW 10 111,106,496 (GRCm39) missense probably benign 0.01
R9249:Osbpl8 UTSW 10 111,122,012 (GRCm39) missense probably benign 0.02
R9380:Osbpl8 UTSW 10 111,108,980 (GRCm39) missense probably damaging 0.99
R9394:Osbpl8 UTSW 10 111,127,375 (GRCm39) nonsense probably null
R9595:Osbpl8 UTSW 10 111,108,909 (GRCm39) missense probably damaging 0.99
RF007:Osbpl8 UTSW 10 111,112,328 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTCCACTGCTCTGTAAGGG -3'
(R):5'- TGCTCCATGTAGGTGGTCTC -3'

Sequencing Primer
(F):5'- TCCACTGCTCTGTAAGGGAAGTC -3'
(R):5'- TTTAAGGGCTCCACAGGCTCAG -3'
Posted On 2020-09-15