Incidental Mutation 'R7988:Fbf1'
ID651611
Institutional Source Beutler Lab
Gene Symbol Fbf1
Ensembl Gene ENSMUSG00000020776
Gene NameFas (TNFRSF6) binding factor 1
Synonyms1110033G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116142285-116168166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116152768 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 405 (D405G)
Ref Sequence ENSEMBL: ENSMUSP00000102043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103031] [ENSMUST00000106435] [ENSMUST00000124828]
Predicted Effect probably benign
Transcript: ENSMUST00000103031
AA Change: D405G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776
AA Change: D405G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106435
AA Change: D405G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776
AA Change: D405G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124828
SMART Domains Protein: ENSMUSP00000114558
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Fbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Fbf1 APN 11 116151081 missense probably benign 0.00
IGL01420:Fbf1 APN 11 116145996 missense probably benign 0.07
IGL01971:Fbf1 APN 11 116143382 unclassified probably benign
IGL01995:Fbf1 APN 11 116151020 missense probably null 0.00
IGL02639:Fbf1 APN 11 116152600 missense probably benign 0.14
IGL02884:Fbf1 APN 11 116146513 missense probably damaging 1.00
IGL03001:Fbf1 APN 11 116165886 start gained probably benign
IGL03309:Fbf1 APN 11 116147811 missense probably damaging 1.00
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0257:Fbf1 UTSW 11 116155091 missense probably benign 0.05
R0394:Fbf1 UTSW 11 116152462 unclassified probably benign
R0637:Fbf1 UTSW 11 116160054 unclassified probably benign
R1512:Fbf1 UTSW 11 116147927 missense probably damaging 1.00
R1679:Fbf1 UTSW 11 116151017 critical splice donor site probably null
R1726:Fbf1 UTSW 11 116145454 missense probably benign
R1909:Fbf1 UTSW 11 116145992 missense possibly damaging 0.79
R1970:Fbf1 UTSW 11 116151491 missense possibly damaging 0.93
R2507:Fbf1 UTSW 11 116155426 missense probably benign
R2847:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2849:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2867:Fbf1 UTSW 11 116161448 unclassified probably benign
R3161:Fbf1 UTSW 11 116148220 missense probably damaging 1.00
R3711:Fbf1 UTSW 11 116161473 missense possibly damaging 0.66
R3711:Fbf1 UTSW 11 116163353 missense probably damaging 1.00
R3752:Fbf1 UTSW 11 116147796 missense probably benign 0.21
R4293:Fbf1 UTSW 11 116148894 missense probably damaging 1.00
R4344:Fbf1 UTSW 11 116147742 missense probably benign
R4345:Fbf1 UTSW 11 116147742 missense probably benign
R4604:Fbf1 UTSW 11 116158922 missense possibly damaging 0.81
R4828:Fbf1 UTSW 11 116148951 missense probably benign 0.00
R4936:Fbf1 UTSW 11 116152552 missense probably benign 0.05
R5561:Fbf1 UTSW 11 116157820 missense probably damaging 1.00
R6392:Fbf1 UTSW 11 116152949 critical splice acceptor site probably null
R6559:Fbf1 UTSW 11 116155446 missense probably benign 0.15
R6993:Fbf1 UTSW 11 116152784 missense probably benign
R7207:Fbf1 UTSW 11 116149474 missense probably benign 0.01
R7544:Fbf1 UTSW 11 116165833 missense probably benign 0.01
R8230:Fbf1 UTSW 11 116146739 missense probably benign
R8262:Fbf1 UTSW 11 116154019 missense probably benign 0.19
R8508:Fbf1 UTSW 11 116165881 start codon destroyed probably null 0.00
X0020:Fbf1 UTSW 11 116150793 missense possibly damaging 0.78
X0060:Fbf1 UTSW 11 116148856 nonsense probably null
X0062:Fbf1 UTSW 11 116149426 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTGAGATATGACATGGCTTAACC -3'
(R):5'- ACAGAATCAGTTTCCTCCCCG -3'

Sequencing Primer
(F):5'- GGCTTAACCAGTCATCTTCTTTC -3'
(R):5'- TCCTCTTTGTCTTGAAGCAGG -3'
Posted On2020-09-15