Incidental Mutation 'R7988:Serpinb9c'
ID651613
Institutional Source Beutler Lab
Gene Symbol Serpinb9c
Ensembl Gene ENSMUSG00000021404
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9c
SynonymsNK9, Spi11, ovalbumin, 3830421J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33149275-33159742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33150279 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 288 (Y288F)
Ref Sequence ENSEMBL: ENSMUSP00000021837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021837] [ENSMUST00000110284]
Predicted Effect probably benign
Transcript: ENSMUST00000021837
AA Change: Y288F

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021837
Gene: ENSMUSG00000021404
AA Change: Y288F

DomainStartEndE-ValueType
SERPIN 24 387 2.85e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110284
AA Change: Y260F

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105913
Gene: ENSMUSG00000021404
AA Change: Y260F

DomainStartEndE-ValueType
SERPIN 1 359 1.21e-146 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Serpinb9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Serpinb9c APN 13 33151884 missense probably damaging 0.98
IGL01357:Serpinb9c APN 13 33151879 missense probably benign 0.02
IGL01413:Serpinb9c APN 13 33151804 missense probably damaging 0.99
R1411:Serpinb9c UTSW 13 33151834 missense probably benign 0.02
R1926:Serpinb9c UTSW 13 33150235 missense probably benign 0.00
R2057:Serpinb9c UTSW 13 33156871 nonsense probably null
R2058:Serpinb9c UTSW 13 33156871 nonsense probably null
R2059:Serpinb9c UTSW 13 33156871 nonsense probably null
R2272:Serpinb9c UTSW 13 33154541 missense probably damaging 1.00
R3948:Serpinb9c UTSW 13 33150094 missense probably benign
R4520:Serpinb9c UTSW 13 33151857 splice site probably null
R4558:Serpinb9c UTSW 13 33154499 missense probably benign 0.12
R4735:Serpinb9c UTSW 13 33150271 missense probably benign 0.13
R5004:Serpinb9c UTSW 13 33150355 missense probably benign 0.00
R5009:Serpinb9c UTSW 13 33154431 missense probably benign 0.18
R6345:Serpinb9c UTSW 13 33149995 missense probably damaging 1.00
R6801:Serpinb9c UTSW 13 33157824 start codon destroyed probably benign 0.00
R6886:Serpinb9c UTSW 13 33150327 missense probably benign 0.04
R7082:Serpinb9c UTSW 13 33154407 missense probably benign 0.40
R7288:Serpinb9c UTSW 13 33151900 missense possibly damaging 0.66
R8309:Serpinb9c UTSW 13 33150111 missense possibly damaging 0.70
R8465:Serpinb9c UTSW 13 33150033 missense probably damaging 1.00
R8543:Serpinb9c UTSW 13 33156434 missense probably damaging 1.00
R8750:Serpinb9c UTSW 13 33151810 missense probably null 0.93
Predicted Primers PCR Primer
(F):5'- TCTGGCCATCATGAGTTTCAGC -3'
(R):5'- ATGCTGTGAACAGGGAGTACC -3'

Sequencing Primer
(F):5'- ACAGTATCATCAGCTGTGGC -3'
(R):5'- CCTATGTGGCTCTGAATAAGACC -3'
Posted On2020-09-15