Incidental Mutation 'R7988:2010111I01Rik'
ID651615
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63061140 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 357 (D357G)
Ref Sequence ENSEMBL: ENSMUSP00000089148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]
Predicted Effect probably null
Transcript: ENSMUST00000021911
AA Change: D355G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: D355G

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091560
AA Change: D357G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: D357G

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
PIT4378001:2010111I01Rik UTSW 13 63015207 missense probably damaging 1.00
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 splice site probably null
R1233:2010111I01Rik UTSW 13 63199520 missense probably damaging 0.96
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
R7038:2010111I01Rik UTSW 13 63190525 missense possibly damaging 0.54
R7493:2010111I01Rik UTSW 13 63015531 missense probably benign 0.01
R7788:2010111I01Rik UTSW 13 63156593 missense possibly damaging 0.89
R7970:2010111I01Rik UTSW 13 63033160 missense probably benign 0.11
R8041:2010111I01Rik UTSW 13 63033107 missense probably damaging 1.00
R8052:2010111I01Rik UTSW 13 63068251 missense probably damaging 1.00
R8053:2010111I01Rik UTSW 13 63190531 nonsense probably null
R8537:2010111I01Rik UTSW 13 63190550 missense probably damaging 1.00
R8554:2010111I01Rik UTSW 13 63296897 missense possibly damaging 0.94
R8681:2010111I01Rik UTSW 13 63190559 missense probably damaging 1.00
Z1177:2010111I01Rik UTSW 13 63170990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCCATAGGCTCTTCGAG -3'
(R):5'- AGAAGAGTTCCATCCACCTGC -3'

Sequencing Primer
(F):5'- GAGAAGACTAGAATTGAGTAGGGTTC -3'
(R):5'- TCGGGAGCGCATATTCCTG -3'
Posted On2020-09-15