Mutagenetix > Incidental Mutation

Incidental Mutation 'R7988:2010111I01Rik'

651615

Institutional Source

Beutler Lab

Gene Symbol

2010111I01Rik

Ensembl Gene

ENSMUSG00000021458

Gene Name

RIKEN cDNA 2010111I01 gene

Synonyms

ApO, aminopeptidase O

MMRRC Submission

046029-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R7988 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62964893-63326096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63061140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 357 (D357G)

Ref Sequence

ENSEMBL: ENSMUSP00000089148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000021911
AA Change: D355G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: D355G

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	221	359	5.4e-11	PFAM
Pfam:Peptidase_M1	385	558	2.3e-15	PFAM
Pfam:Peptidase_MA_2	453	613	1.3e-12	PFAM
Leuk-A4-hydro_C	675	821	3.02e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091560
AA Change: D357G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: D357G

Domain	Start	End	E-Value	Type
low complexity region	143	154	N/A	INTRINSIC
Pfam:Peptidase_M1	220	359	2.7e-11	PFAM
Pfam:Peptidase_M1	386	561	1.9e-15	PFAM
Leuk-A4-hydro_C	676	822	3.02e-37	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	C	T	6: 72,347,652	T56M	probably damaging	Het
4932415D10Rik	T	C	10: 82,296,100	I359V	probably benign	Het
Adamtsl5	C	T	10: 80,345,538	S36N	probably benign	Het
Adgrf5	A	T	17: 43,439,813		probably benign	Het
Ago1	A	G	4: 126,460,417	F200S	probably damaging	Het
Akr1cl	T	C	1: 65,024,706	D108G	possibly damaging	Het
Arhgef3	A	T	14: 27,401,786	D468V	probably benign	Het
Aspn	T	C	13: 49,551,877	C72R	possibly damaging	Het
Baz2b	T	C	2: 59,962,141	T548A	possibly damaging	Het
Birc6	G	A	17: 74,599,373		probably null	Het
Btnl2	A	T	17: 34,358,275	T135S	possibly damaging	Het
Ccnl1	T	A	3: 65,957,861	I90F	possibly damaging	Het
Ccnt1	T	C	15: 98,565,143		probably null	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap45	A	G	1: 172,529,934	D85G	probably damaging	Het
Cfap54	T	A	10: 92,902,079	D2319V	unknown	Het
Cma1	T	C	14: 55,944,532	M14V	possibly damaging	Het
Cmtm1	T	C	8: 104,310,142		probably benign	Het
Col27a1	A	G	4: 63,331,322	H1738R	unknown	Het
Colq	T	A	14: 31,553,837	D41V	probably damaging	Het
Cubn	T	C	2: 13,332,355	T2437A	probably benign	Het
Dnah14	A	G	1: 181,783,574	D3755G	probably damaging	Het
Eprs	A	G	1: 185,418,348	Y1349C	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fam196a	T	G	7: 134,917,698	K368Q	probably damaging	Het
Fbf1	T	C	11: 116,152,768	D405G	probably benign	Het
Fen1	C	T	19: 10,200,310	E257K	possibly damaging	Het
Gstm7	A	T	3: 107,926,955	M198K	possibly damaging	Het
Hook3	A	T	8: 26,073,647	S190T	probably benign	Het
Htra4	A	C	8: 25,030,510		probably null	Het
Ighv1-15	T	C	12: 114,657,496	I70V	probably benign	Het
Ikzf4	T	A	10: 128,634,455	N452Y	probably damaging	Het
Iqcf5	T	A	9: 106,515,821	N92K	possibly damaging	Het
Itk	A	G	11: 46,355,834	Y186H	probably damaging	Het
Klhdc10	T	C	6: 30,446,691	S282P	probably benign	Het
Klhl18	T	A	9: 110,476,509	E29V	possibly damaging	Het
Ky	T	C	9: 102,525,415	S140P	probably damaging	Het
Lmntd2	T	C	7: 141,213,637	E112G	unknown	Het
Lrrc36	C	A	8: 105,452,086	D304E	possibly damaging	Het
Macf1	A	T	4: 123,506,480	F674Y	probably damaging	Het
Notch1	C	T	2: 26,471,001	D1111N	probably benign	Het
Osbpl8	T	G	10: 111,272,080	N312K	possibly damaging	Het
Otogl	C	T	10: 107,895,776	C168Y	probably damaging	Het
Phldb2	T	G	16: 45,825,571	T171P	probably benign	Het
Ppef2	A	T	5: 92,238,982	F365L	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Ryr1	G	A	7: 29,096,171	T1105I	probably benign	Het
Sclt1	T	A	3: 41,663,454	*29L	probably null	Het
Scn11a	T	C	9: 119,765,437	K1297E	probably damaging	Het
Serpinb9c	T	A	13: 33,150,279	Y288F	probably benign	Het
Setd1a	T	A	7: 127,786,194	M691K	probably benign	Het
Sftpc	T	C	14: 70,522,619	E66G	probably damaging	Het
Thnsl2	T	C	6: 71,141,319	T42A	probably benign	Het
Tram1	T	C	1: 13,569,975	D285G	probably benign	Het
Ttn	A	T	2: 76,736,240	I28103K	probably damaging	Het
Ttn	G	A	2: 76,845,030	P11137L	unknown	Het
Ttn	C	A	2: 76,896,759	V5821F	unknown	Het
Usp38	T	A	8: 81,014,316	M41L	probably benign	Het
Zcwpw1	T	G	5: 137,817,491	Y419D	possibly damaging	Het
Zfp407	G	A	18: 84,559,400	A1196V	possibly damaging	Het
Zfp446	T	A	7: 12,979,043	S103T	possibly damaging	Het

Other mutations in 2010111I01Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:2010111I01Rik	APN	13	63199500	splice site	probably benign
IGL00329:2010111I01Rik	APN	13	63191163	missense	probably damaging	1.00
IGL00336:2010111I01Rik	APN	13	63015423	missense	possibly damaging	0.78
IGL01384:2010111I01Rik	APN	13	63190476	splice site	probably benign
IGL01780:2010111I01Rik	APN	13	63210125	missense	probably benign	0.00
IGL01876:2010111I01Rik	APN	13	63190522	missense	probably damaging	1.00
IGL02096:2010111I01Rik	APN	13	63061089	missense	probably benign	0.04
IGL02166:2010111I01Rik	APN	13	63015453	missense	probably benign	0.02
IGL02184:2010111I01Rik	APN	13	63068111	missense	possibly damaging	0.50
PIT4378001:2010111I01Rik	UTSW	13	63015207	missense	probably damaging	1.00
R0139:2010111I01Rik	UTSW	13	63190484	missense	probably benign	0.01
R1209:2010111I01Rik	UTSW	13	63191064	splice site	probably null
R1233:2010111I01Rik	UTSW	13	63199520	missense	probably damaging	0.96
R1756:2010111I01Rik	UTSW	13	63068061	missense	possibly damaging	0.95
R1786:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R1861:2010111I01Rik	UTSW	13	63015783	missense	probably damaging	1.00
R2130:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R2131:2010111I01Rik	UTSW	13	63210149	missense	probably benign	0.00
R3076:2010111I01Rik	UTSW	13	63240115	missense	probably damaging	0.96
R3702:2010111I01Rik	UTSW	13	63015330	missense	probably benign	0.01
R3912:2010111I01Rik	UTSW	13	63156706	nonsense	probably null
R4512:2010111I01Rik	UTSW	13	63156667	missense	probably damaging	0.99
R4593:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4596:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4597:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4616:2010111I01Rik	UTSW	13	63298751	missense	probably damaging	1.00
R4625:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4627:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4630:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4632:2010111I01Rik	UTSW	13	63068092	missense	probably benign	0.01
R4911:2010111I01Rik	UTSW	13	63170939	critical splice acceptor site	probably null
R5204:2010111I01Rik	UTSW	13	63033090	missense	probably benign	0.15
R5210:2010111I01Rik	UTSW	13	63068110	missense	probably benign	0.00
R5849:2010111I01Rik	UTSW	13	63015498	missense	probably benign	0.00
R5861:2010111I01Rik	UTSW	13	63298812	missense	probably damaging	1.00
R5960:2010111I01Rik	UTSW	13	63240273	missense	probably damaging	0.99
R6021:2010111I01Rik	UTSW	13	63061082	missense	probably damaging	1.00
R6048:2010111I01Rik	UTSW	13	63240325	missense	probably damaging	0.99
R6379:2010111I01Rik	UTSW	13	63068243	missense	probably damaging	0.97
R7038:2010111I01Rik	UTSW	13	63190525	missense	possibly damaging	0.54
R7493:2010111I01Rik	UTSW	13	63015531	missense	probably benign	0.01
R7788:2010111I01Rik	UTSW	13	63156593	missense	possibly damaging	0.89
R7970:2010111I01Rik	UTSW	13	63033160	missense	probably benign	0.11
R8041:2010111I01Rik	UTSW	13	63033107	missense	probably damaging	1.00
R8052:2010111I01Rik	UTSW	13	63068251	missense	probably damaging	1.00
R8053:2010111I01Rik	UTSW	13	63190531	nonsense	probably null
R8537:2010111I01Rik	UTSW	13	63190550	missense	probably damaging	1.00
R8554:2010111I01Rik	UTSW	13	63296897	missense	possibly damaging	0.94
R8681:2010111I01Rik	UTSW	13	63190559	missense	probably damaging	1.00
R8909:2010111I01Rik	UTSW	13	63240297	missense	possibly damaging	0.95
R8945:2010111I01Rik	UTSW	13	63240331	missense	probably null	1.00
R8990:2010111I01Rik	UTSW	13	63156614	missense	probably damaging	1.00
R9032:2010111I01Rik	UTSW	13	63296867	nonsense	probably null
R9049:2010111I01Rik	UTSW	13	63061038	missense	probably benign	0.00
R9166:2010111I01Rik	UTSW	13	63171048	critical splice donor site	probably null
R9590:2010111I01Rik	UTSW	13	63061109	missense	probably benign
Z1177:2010111I01Rik	UTSW	13	63170990	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTCCCATAGGCTCTTCGAG -3'
(R):5'- AGAAGAGTTCCATCCACCTGC -3'

Sequencing Primer
(F):5'- GAGAAGACTAGAATTGAGTAGGGTTC -3'
(R):5'- TCGGGAGCGCATATTCCTG -3'

Posted On

2020-09-15