Incidental Mutation 'R7988:Arhgef3'
ID 651616
Institutional Source Beutler Lab
Gene Symbol Arhgef3
Ensembl Gene ENSMUSG00000021895
Gene Name Rho guanine nucleotide exchange factor 3
Synonyms 9830169H03Rik, C76747, 1200004I24Rik
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 26836856-27125868 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27123743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 468 (D468V)
Ref Sequence ENSEMBL: ENSMUSP00000046486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049206] [ENSMUST00000224981] [ENSMUST00000225949]
AlphaFold Q91X46
Predicted Effect probably benign
Transcript: ENSMUST00000049206
AA Change: D468V

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000046486
Gene: ENSMUSG00000021895
AA Change: D468V

DomainStartEndE-ValueType
RhoGEF 132 309 4.11e-51 SMART
PH 318 457 3.26e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000224981
AA Change: D461V

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000225949
AA Change: D488V

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho-like GTPases are involved in a variety of cellular processes, and they are activated by binding GTP and inactivated by conversion of GTP to GDP by their intrinsic GTPase activity. Guanine nucleotide exchange factors (GEFs) accelerate the GTPase activity of Rho GTPases by catalyzing their release of bound GDP. This gene encodes a guanine nucleotide exchange factor, which specifically activates two members of the Rho GTPase family: RHOA and RHOB, both of which have a role in bone cell biology. It has been identified that genetic variation in this gene plays a role in the determination of bone mineral density (BMD), indicating the implication of this gene in postmenopausal osteoporosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean platelet volume and a mild delay in platelet recovery in response to thrombocytopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Arhgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Arhgef3 APN 14 27,123,876 (GRCm39) nonsense probably null
IGL02178:Arhgef3 APN 14 26,987,486 (GRCm39) nonsense probably null
IGL02302:Arhgef3 APN 14 27,084,799 (GRCm39) missense probably benign 0.08
IGL02505:Arhgef3 APN 14 27,115,957 (GRCm39) missense possibly damaging 0.92
IGL03203:Arhgef3 APN 14 27,116,073 (GRCm39) missense probably damaging 1.00
IGL03339:Arhgef3 APN 14 27,123,814 (GRCm39) missense probably damaging 0.99
R0762:Arhgef3 UTSW 14 27,119,584 (GRCm39) missense probably damaging 1.00
R1192:Arhgef3 UTSW 14 27,101,663 (GRCm39) missense probably damaging 1.00
R1572:Arhgef3 UTSW 14 27,123,692 (GRCm39) missense probably damaging 1.00
R1794:Arhgef3 UTSW 14 27,119,562 (GRCm39) missense probably benign 0.44
R2426:Arhgef3 UTSW 14 27,106,138 (GRCm39) nonsense probably null
R2509:Arhgef3 UTSW 14 27,101,633 (GRCm39) missense probably damaging 1.00
R4932:Arhgef3 UTSW 14 27,106,170 (GRCm39) missense probably damaging 0.99
R5017:Arhgef3 UTSW 14 26,987,487 (GRCm39) missense possibly damaging 0.85
R5216:Arhgef3 UTSW 14 27,123,799 (GRCm39) missense probably benign 0.00
R6562:Arhgef3 UTSW 14 26,874,953 (GRCm39) start gained probably benign
R6951:Arhgef3 UTSW 14 26,865,975 (GRCm39) start gained probably benign
R7140:Arhgef3 UTSW 14 27,123,664 (GRCm39) missense probably damaging 1.00
R7361:Arhgef3 UTSW 14 26,987,535 (GRCm39) missense possibly damaging 0.56
R7968:Arhgef3 UTSW 14 27,116,062 (GRCm39) missense probably damaging 1.00
R7968:Arhgef3 UTSW 14 27,108,070 (GRCm39) missense probably damaging 0.99
R8042:Arhgef3 UTSW 14 27,084,766 (GRCm39) missense possibly damaging 0.85
R8077:Arhgef3 UTSW 14 27,107,881 (GRCm39) missense probably damaging 1.00
R8303:Arhgef3 UTSW 14 27,116,095 (GRCm39) missense probably damaging 0.99
R9199:Arhgef3 UTSW 14 27,122,244 (GRCm39) missense possibly damaging 0.82
R9365:Arhgef3 UTSW 14 27,101,555 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATTAGGGCCACTCTGTGTG -3'
(R):5'- TTTGCACAGGAAGCGTCTGTC -3'

Sequencing Primer
(F):5'- TGTTAGCCTTGACAAATACCTACC -3'
(R):5'- CACAGGAAGCGTCTGTCTGTTC -3'
Posted On 2020-09-15