Incidental Mutation 'R7988:Sftpc'
ID651619
Institutional Source Beutler Lab
Gene Symbol Sftpc
Ensembl Gene ENSMUSG00000022097
Gene Namesurfactant associated protein C
SynonymsSftp-2, SPC, SP-C, Sftp2, pro-SpC, Bricd6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70520949-70524081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70522619 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 66 (E66G)
Ref Sequence ENSEMBL: ENSMUSP00000022692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022692] [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906]
Predicted Effect probably damaging
Transcript: ENSMUST00000022692
AA Change: E66G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022692
Gene: ENSMUSG00000022097
AA Change: E66G

DomainStartEndE-ValueType
SF_P 1 193 7.3e-150 SMART
BRICHOS 94 193 3.29e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022693
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pulmonary-associated surfactant protein C (SPC), an extremely hydrophobic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 2, also called pulmonary alveolar proteinosis due to surfactant protein C deficiency, and are associated with interstitial lung disease in older infants, children, and adults. Alternatively spliced transcript variants encoding different protein isoforms have been identified.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display respiratory abnormalities similar to emphysema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Fen1 C T 19: 10,200,310 E257K possibly damaging Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Sftpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Sftpc APN 14 70521869 missense probably damaging 0.99
R0158:Sftpc UTSW 14 70521447 missense probably null 0.15
R0305:Sftpc UTSW 14 70524078 unclassified probably benign
R0448:Sftpc UTSW 14 70522680 missense probably benign 0.13
R0463:Sftpc UTSW 14 70522670 missense probably damaging 1.00
R3028:Sftpc UTSW 14 70521425 missense probably benign 0.40
R4623:Sftpc UTSW 14 70522278 critical splice acceptor site probably null
R7593:Sftpc UTSW 14 70522183 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGTTATCACACTAGGCCGG -3'
(R):5'- CTCGTAGCCTAAAGAGGTACGG -3'

Sequencing Primer
(F):5'- CACCCAAGATGTGCTCAT -3'
(R):5'- AGAGTAGGAGCCACCCTCTC -3'
Posted On2020-09-15