Incidental Mutation 'R7988:Phldb2'
ID 651620
Institutional Source Beutler Lab
Gene Symbol Phldb2
Ensembl Gene ENSMUSG00000033149
Gene Name pleckstrin homology like domain, family B, member 2
Synonyms LL5b, C820004H04Rik, LL5beta
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45566606-45773961 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 45645934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 171 (T171P)
Ref Sequence ENSEMBL: ENSMUSP00000075672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036355] [ENSMUST00000076333] [ENSMUST00000134802] [ENSMUST00000136405]
AlphaFold Q8K1N2
Predicted Effect probably benign
Transcript: ENSMUST00000036355
AA Change: T171P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046496
Gene: ENSMUSG00000033149
AA Change: T171P

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
coiled coil region 1027 1097 N/A INTRINSIC
PH 1140 1244 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076333
AA Change: T171P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000075672
Gene: ENSMUSG00000033149
AA Change: T171P

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
coiled coil region 580 692 N/A INTRINSIC
coiled coil region 724 800 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
coiled coil region 1080 1150 N/A INTRINSIC
PH 1193 1297 6.45e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134802
AA Change: T216P

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123284
Gene: ENSMUSG00000033149
AA Change: T216P

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
coiled coil region 625 737 N/A INTRINSIC
coiled coil region 769 845 N/A INTRINSIC
coiled coil region 1072 1131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136405
SMART Domains Protein: ENSMUSP00000121800
Gene: ENSMUSG00000033149

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Fen1 C T 19: 10,177,674 (GRCm39) E257K possibly damaging Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Phldb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Phldb2 APN 16 45,592,617 (GRCm39) missense probably damaging 1.00
IGL00485:Phldb2 APN 16 45,577,551 (GRCm39) missense possibly damaging 0.75
IGL00544:Phldb2 APN 16 45,645,674 (GRCm39) missense probably damaging 1.00
IGL00547:Phldb2 APN 16 45,645,898 (GRCm39) missense probably benign 0.00
IGL00835:Phldb2 APN 16 45,571,819 (GRCm39) missense probably damaging 1.00
IGL00987:Phldb2 APN 16 45,583,465 (GRCm39) missense possibly damaging 0.78
IGL01102:Phldb2 APN 16 45,645,423 (GRCm39) missense probably damaging 1.00
IGL01530:Phldb2 APN 16 45,623,092 (GRCm39) missense probably damaging 1.00
IGL01549:Phldb2 APN 16 45,594,681 (GRCm39) missense probably benign 0.00
IGL01712:Phldb2 APN 16 45,571,792 (GRCm39) missense probably damaging 1.00
IGL01755:Phldb2 APN 16 45,645,945 (GRCm39) missense probably damaging 0.96
IGL01823:Phldb2 APN 16 45,645,507 (GRCm39) missense probably damaging 0.97
IGL02353:Phldb2 APN 16 45,569,142 (GRCm39) missense probably damaging 1.00
IGL02360:Phldb2 APN 16 45,569,142 (GRCm39) missense probably damaging 1.00
IGL02716:Phldb2 APN 16 45,621,953 (GRCm39) missense probably damaging 0.99
R0139:Phldb2 UTSW 16 45,591,029 (GRCm39) splice site probably benign
R0312:Phldb2 UTSW 16 45,609,410 (GRCm39) missense probably damaging 1.00
R0379:Phldb2 UTSW 16 45,601,814 (GRCm39) missense probably damaging 1.00
R0535:Phldb2 UTSW 16 45,577,490 (GRCm39) missense probably damaging 1.00
R1387:Phldb2 UTSW 16 45,646,357 (GRCm39) missense possibly damaging 0.69
R1444:Phldb2 UTSW 16 45,577,616 (GRCm39) splice site probably benign
R1487:Phldb2 UTSW 16 45,609,387 (GRCm39) missense probably damaging 1.00
R1501:Phldb2 UTSW 16 45,598,146 (GRCm39) missense probably damaging 1.00
R1605:Phldb2 UTSW 16 45,591,142 (GRCm39) splice site probably benign
R1716:Phldb2 UTSW 16 45,595,413 (GRCm39) missense probably benign 0.01
R1732:Phldb2 UTSW 16 45,577,529 (GRCm39) missense probably damaging 1.00
R1779:Phldb2 UTSW 16 45,621,988 (GRCm39) missense probably damaging 1.00
R1824:Phldb2 UTSW 16 45,646,374 (GRCm39) missense probably benign 0.14
R2001:Phldb2 UTSW 16 45,594,558 (GRCm39) missense possibly damaging 0.66
R2066:Phldb2 UTSW 16 45,591,121 (GRCm39) missense probably damaging 1.00
R2122:Phldb2 UTSW 16 45,583,304 (GRCm39) missense probably damaging 0.99
R2448:Phldb2 UTSW 16 45,645,726 (GRCm39) missense probably damaging 1.00
R2932:Phldb2 UTSW 16 45,569,148 (GRCm39) missense possibly damaging 0.85
R3076:Phldb2 UTSW 16 45,645,373 (GRCm39) missense probably benign 0.00
R3078:Phldb2 UTSW 16 45,645,373 (GRCm39) missense probably benign 0.00
R3779:Phldb2 UTSW 16 45,569,118 (GRCm39) missense probably damaging 1.00
R3914:Phldb2 UTSW 16 45,577,526 (GRCm39) missense probably damaging 1.00
R4536:Phldb2 UTSW 16 45,591,044 (GRCm39) missense probably benign 0.04
R4568:Phldb2 UTSW 16 45,598,081 (GRCm39) nonsense probably null
R4798:Phldb2 UTSW 16 45,646,237 (GRCm39) missense probably damaging 1.00
R4853:Phldb2 UTSW 16 45,623,079 (GRCm39) missense probably damaging 0.99
R4906:Phldb2 UTSW 16 45,571,758 (GRCm39) missense probably damaging 1.00
R4984:Phldb2 UTSW 16 45,645,996 (GRCm39) missense probably damaging 1.00
R5078:Phldb2 UTSW 16 45,598,105 (GRCm39) missense possibly damaging 0.85
R5137:Phldb2 UTSW 16 45,628,621 (GRCm39) missense possibly damaging 0.85
R5237:Phldb2 UTSW 16 45,568,249 (GRCm39) missense probably damaging 0.99
R5410:Phldb2 UTSW 16 45,645,975 (GRCm39) missense possibly damaging 0.77
R5825:Phldb2 UTSW 16 45,583,460 (GRCm39) missense probably benign 0.11
R5874:Phldb2 UTSW 16 45,621,988 (GRCm39) missense probably damaging 1.00
R5907:Phldb2 UTSW 16 45,645,551 (GRCm39) missense probably damaging 1.00
R6332:Phldb2 UTSW 16 45,594,609 (GRCm39) missense probably benign
R6354:Phldb2 UTSW 16 45,645,477 (GRCm39) missense probably damaging 1.00
R6355:Phldb2 UTSW 16 45,645,701 (GRCm39) missense probably damaging 0.99
R6383:Phldb2 UTSW 16 45,569,113 (GRCm39) missense probably damaging 1.00
R6463:Phldb2 UTSW 16 45,595,356 (GRCm39) missense probably benign 0.37
R6513:Phldb2 UTSW 16 45,568,240 (GRCm39) missense possibly damaging 0.96
R6593:Phldb2 UTSW 16 45,645,790 (GRCm39) nonsense probably null
R6756:Phldb2 UTSW 16 45,628,683 (GRCm39) missense probably benign 0.02
R6810:Phldb2 UTSW 16 45,569,088 (GRCm39) critical splice donor site probably null
R6897:Phldb2 UTSW 16 45,598,138 (GRCm39) missense probably damaging 1.00
R7010:Phldb2 UTSW 16 45,571,868 (GRCm39) missense probably damaging 0.99
R7142:Phldb2 UTSW 16 45,577,539 (GRCm39) nonsense probably null
R7149:Phldb2 UTSW 16 45,571,895 (GRCm39) nonsense probably null
R7249:Phldb2 UTSW 16 45,621,977 (GRCm39) missense probably damaging 1.00
R7300:Phldb2 UTSW 16 45,645,925 (GRCm39) missense probably damaging 1.00
R7328:Phldb2 UTSW 16 45,578,572 (GRCm39) critical splice acceptor site probably null
R7515:Phldb2 UTSW 16 45,594,603 (GRCm39) missense possibly damaging 0.90
R7840:Phldb2 UTSW 16 45,571,727 (GRCm39) missense probably damaging 1.00
R8159:Phldb2 UTSW 16 45,680,747 (GRCm39) missense possibly damaging 0.82
R8353:Phldb2 UTSW 16 45,645,385 (GRCm39) missense probably benign 0.00
R8453:Phldb2 UTSW 16 45,645,385 (GRCm39) missense probably benign 0.00
R8969:Phldb2 UTSW 16 45,592,496 (GRCm39) critical splice donor site probably null
R9058:Phldb2 UTSW 16 45,592,604 (GRCm39) missense possibly damaging 0.88
R9106:Phldb2 UTSW 16 45,680,757 (GRCm39) missense probably benign 0.05
R9278:Phldb2 UTSW 16 45,646,308 (GRCm39) missense probably damaging 0.99
R9324:Phldb2 UTSW 16 45,595,437 (GRCm39) missense probably damaging 0.99
R9563:Phldb2 UTSW 16 45,645,247 (GRCm39) missense possibly damaging 0.90
R9626:Phldb2 UTSW 16 45,592,547 (GRCm39) missense possibly damaging 0.93
R9712:Phldb2 UTSW 16 45,595,340 (GRCm39) missense probably benign 0.27
R9718:Phldb2 UTSW 16 45,601,756 (GRCm39) missense possibly damaging 0.67
RF008:Phldb2 UTSW 16 45,583,337 (GRCm39) missense probably damaging 1.00
Z1176:Phldb2 UTSW 16 45,773,871 (GRCm39) unclassified probably benign
Z1176:Phldb2 UTSW 16 45,646,190 (GRCm39) missense probably benign 0.04
Z1176:Phldb2 UTSW 16 45,646,189 (GRCm39) missense probably benign 0.43
Z1190:Phldb2 UTSW 16 45,645,697 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTGCCTGCTTAACCTGG -3'
(R):5'- AGCAAACAGTTCTGCGATGG -3'

Sequencing Primer
(F):5'- CTGCTTAACCTGGGCTGAAG -3'
(R):5'- CAAACAGTTCTGCGATGGAATTG -3'
Posted On 2020-09-15