Incidental Mutation 'R7988:Fen1'
ID651623
Institutional Source Beutler Lab
Gene Symbol Fen1
Ensembl Gene ENSMUSG00000024742
Gene Nameflap structure specific endonuclease 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10199132-10204169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10200310 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 257 (E257K)
Ref Sequence ENSEMBL: ENSMUSP00000025651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807] [ENSMUST00000025651] [ENSMUST00000040372] [ENSMUST00000116542] [ENSMUST00000142241] [ENSMUST00000156291]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000025651
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025651
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040372
SMART Domains Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 3 79 3.3e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116542
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112241
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142241
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119221
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156291
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117246
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not form an inner cell mass, lack DNA synthesis in blastocyst giant cells and die by embryonic day 9.5. Embryonic day 3.5 blastocysts are hypersensitive to irradiation. Heterozygotes show enhanced adenocarcinoma susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,347,652 T56M probably damaging Het
2010111I01Rik A G 13: 63,061,140 D357G probably benign Het
4932415D10Rik T C 10: 82,296,100 I359V probably benign Het
Adamtsl5 C T 10: 80,345,538 S36N probably benign Het
Adgrf5 A T 17: 43,439,813 probably benign Het
Ago1 A G 4: 126,460,417 F200S probably damaging Het
Akr1cl T C 1: 65,024,706 D108G possibly damaging Het
Arhgef3 A T 14: 27,401,786 D468V probably benign Het
Aspn T C 13: 49,551,877 C72R possibly damaging Het
Baz2b T C 2: 59,962,141 T548A possibly damaging Het
Birc6 G A 17: 74,599,373 probably null Het
Btnl2 A T 17: 34,358,275 T135S possibly damaging Het
Ccnl1 T A 3: 65,957,861 I90F possibly damaging Het
Ccnt1 T C 15: 98,565,143 probably null Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap45 A G 1: 172,529,934 D85G probably damaging Het
Cfap54 T A 10: 92,902,079 D2319V unknown Het
Cma1 T C 14: 55,944,532 M14V possibly damaging Het
Cmtm1 T C 8: 104,310,142 probably benign Het
Col27a1 A G 4: 63,331,322 H1738R unknown Het
Colq T A 14: 31,553,837 D41V probably damaging Het
Cubn T C 2: 13,332,355 T2437A probably benign Het
Dnah14 A G 1: 181,783,574 D3755G probably damaging Het
Eprs A G 1: 185,418,348 Y1349C probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam196a T G 7: 134,917,698 K368Q probably damaging Het
Fbf1 T C 11: 116,152,768 D405G probably benign Het
Gstm7 A T 3: 107,926,955 M198K possibly damaging Het
Hook3 A T 8: 26,073,647 S190T probably benign Het
Htra4 A C 8: 25,030,510 probably null Het
Ighv1-15 T C 12: 114,657,496 I70V probably benign Het
Ikzf4 T A 10: 128,634,455 N452Y probably damaging Het
Iqcf5 T A 9: 106,515,821 N92K possibly damaging Het
Itk A G 11: 46,355,834 Y186H probably damaging Het
Klhdc10 T C 6: 30,446,691 S282P probably benign Het
Klhl18 T A 9: 110,476,509 E29V possibly damaging Het
Ky T C 9: 102,525,415 S140P probably damaging Het
Lmntd2 T C 7: 141,213,637 E112G unknown Het
Lrrc36 C A 8: 105,452,086 D304E possibly damaging Het
Macf1 A T 4: 123,506,480 F674Y probably damaging Het
Notch1 C T 2: 26,471,001 D1111N probably benign Het
Osbpl8 T G 10: 111,272,080 N312K possibly damaging Het
Otogl C T 10: 107,895,776 C168Y probably damaging Het
Phldb2 T G 16: 45,825,571 T171P probably benign Het
Ppef2 A T 5: 92,238,982 F365L probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Ryr1 G A 7: 29,096,171 T1105I probably benign Het
Sclt1 T A 3: 41,663,454 *29L probably null Het
Scn11a T C 9: 119,765,437 K1297E probably damaging Het
Serpinb9c T A 13: 33,150,279 Y288F probably benign Het
Setd1a T A 7: 127,786,194 M691K probably benign Het
Sftpc T C 14: 70,522,619 E66G probably damaging Het
Thnsl2 T C 6: 71,141,319 T42A probably benign Het
Tram1 T C 1: 13,569,975 D285G probably benign Het
Ttn A T 2: 76,736,240 I28103K probably damaging Het
Ttn G A 2: 76,845,030 P11137L unknown Het
Ttn C A 2: 76,896,759 V5821F unknown Het
Usp38 T A 8: 81,014,316 M41L probably benign Het
Zcwpw1 T G 5: 137,817,491 Y419D possibly damaging Het
Zfp407 G A 18: 84,559,400 A1196V possibly damaging Het
Zfp446 T A 7: 12,979,043 S103T possibly damaging Het
Other mutations in Fen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02991:Fen1 UTSW 19 10200662 missense probably benign
R3161:Fen1 UTSW 19 10200291 missense probably damaging 0.96
R4245:Fen1 UTSW 19 10200367 missense probably damaging 0.99
R5481:Fen1 UTSW 19 10200658 missense probably damaging 1.00
R5553:Fen1 UTSW 19 10200423 missense probably benign
R5733:Fen1 UTSW 19 10200658 missense possibly damaging 0.86
R5783:Fen1 UTSW 19 10200830 nonsense probably null
R6244:Fen1 UTSW 19 10200687 missense probably damaging 1.00
R6498:Fen1 UTSW 19 10200115 missense probably damaging 0.96
R6797:Fen1 UTSW 19 10200703 missense probably benign 0.37
R8374:Fen1 UTSW 19 10200460 missense probably benign 0.26
R9016:Fen1 UTSW 19 10200942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCCCACTGCGAATTCG -3'
(R):5'- CGACACTTAACTGCCAGTGAG -3'

Sequencing Primer
(F):5'- GAATTCGCTCTTCAGAAAACTGC -3'
(R):5'- TGAGGCCAAGAAGCTGCC -3'
Posted On2020-09-15