Incidental Mutation 'R7988:Fen1'
ID 651623
Institutional Source Beutler Lab
Gene Symbol Fen1
Ensembl Gene ENSMUSG00000024742
Gene Name flap structure specific endonuclease 1
Synonyms
MMRRC Submission 046029-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7988 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 10176496-10181533 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10177674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 257 (E257K)
Ref Sequence ENSEMBL: ENSMUSP00000025651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807] [ENSMUST00000025651] [ENSMUST00000040372] [ENSMUST00000116542] [ENSMUST00000142241] [ENSMUST00000156291]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000025651
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025651
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040372
SMART Domains Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 3 79 3.3e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116542
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112241
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142241
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119221
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156291
AA Change: E257K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117246
Gene: ENSMUSG00000024742
AA Change: E257K

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not form an inner cell mass, lack DNA synthesis in blastocyst giant cells and die by embryonic day 9.5. Embryonic day 3.5 blastocysts are hypersensitive to irradiation. Heterozygotes show enhanced adenocarcinoma susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik C T 6: 72,324,635 (GRCm39) T56M probably damaging Het
Adamtsl5 C T 10: 80,181,372 (GRCm39) S36N probably benign Het
Adgrf5 A T 17: 43,750,704 (GRCm39) probably benign Het
Ago1 A G 4: 126,354,210 (GRCm39) F200S probably damaging Het
Akr1cl T C 1: 65,063,865 (GRCm39) D108G possibly damaging Het
Aopep A G 13: 63,208,954 (GRCm39) D357G probably benign Het
Arhgef3 A T 14: 27,123,743 (GRCm39) D468V probably benign Het
Aspn T C 13: 49,705,353 (GRCm39) C72R possibly damaging Het
Baz2b T C 2: 59,792,485 (GRCm39) T548A possibly damaging Het
Birc6 G A 17: 74,906,368 (GRCm39) probably null Het
Btnl2 A T 17: 34,577,249 (GRCm39) T135S possibly damaging Het
Ccnl1 T A 3: 65,865,282 (GRCm39) I90F possibly damaging Het
Ccnt1 T C 15: 98,463,024 (GRCm39) probably null Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap45 A G 1: 172,357,501 (GRCm39) D85G probably damaging Het
Cfap54 T A 10: 92,737,941 (GRCm39) D2319V unknown Het
Cma1 T C 14: 56,181,989 (GRCm39) M14V possibly damaging Het
Cmtm1 T C 8: 105,036,774 (GRCm39) probably benign Het
Col27a1 A G 4: 63,249,559 (GRCm39) H1738R unknown Het
Colq T A 14: 31,275,794 (GRCm39) D41V probably damaging Het
Cubn T C 2: 13,337,166 (GRCm39) T2437A probably benign Het
Dnah14 A G 1: 181,611,139 (GRCm39) D3755G probably damaging Het
Eprs1 A G 1: 185,150,545 (GRCm39) Y1349C probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Fbf1 T C 11: 116,043,594 (GRCm39) D405G probably benign Het
Gstm7 A T 3: 107,834,271 (GRCm39) M198K possibly damaging Het
Hook3 A T 8: 26,563,675 (GRCm39) S190T probably benign Het
Htra4 A C 8: 25,520,526 (GRCm39) probably null Het
Ighv1-15 T C 12: 114,621,116 (GRCm39) I70V probably benign Het
Ikzf4 T A 10: 128,470,324 (GRCm39) N452Y probably damaging Het
Insyn2a T G 7: 134,519,427 (GRCm39) K368Q probably damaging Het
Iqcf5 T A 9: 106,393,020 (GRCm39) N92K possibly damaging Het
Itk A G 11: 46,246,661 (GRCm39) Y186H probably damaging Het
Klhdc10 T C 6: 30,446,690 (GRCm39) S282P probably benign Het
Klhl18 T A 9: 110,305,577 (GRCm39) E29V possibly damaging Het
Ky T C 9: 102,402,614 (GRCm39) S140P probably damaging Het
Lmntd2 T C 7: 140,793,550 (GRCm39) E112G unknown Het
Lrrc36 C A 8: 106,178,718 (GRCm39) D304E possibly damaging Het
Macf1 A T 4: 123,400,273 (GRCm39) F674Y probably damaging Het
Notch1 C T 2: 26,361,013 (GRCm39) D1111N probably benign Het
Osbpl8 T G 10: 111,107,941 (GRCm39) N312K possibly damaging Het
Otogl C T 10: 107,731,637 (GRCm39) C168Y probably damaging Het
Phldb2 T G 16: 45,645,934 (GRCm39) T171P probably benign Het
Ppef2 A T 5: 92,386,841 (GRCm39) F365L probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Ryr1 G A 7: 28,795,596 (GRCm39) T1105I probably benign Het
Sclt1 T A 3: 41,617,889 (GRCm39) *29L probably null Het
Scn11a T C 9: 119,594,503 (GRCm39) K1297E probably damaging Het
Serpinb9c T A 13: 33,334,262 (GRCm39) Y288F probably benign Het
Setd1a T A 7: 127,385,366 (GRCm39) M691K probably benign Het
Sftpc T C 14: 70,760,059 (GRCm39) E66G probably damaging Het
Spata31h1 T C 10: 82,131,934 (GRCm39) I359V probably benign Het
Thnsl2 T C 6: 71,118,303 (GRCm39) T42A probably benign Het
Tram1 T C 1: 13,640,199 (GRCm39) D285G probably benign Het
Ttn G A 2: 76,675,374 (GRCm39) P11137L unknown Het
Ttn C A 2: 76,727,103 (GRCm39) V5821F unknown Het
Ttn A T 2: 76,566,584 (GRCm39) I28103K probably damaging Het
Usp38 T A 8: 81,740,945 (GRCm39) M41L probably benign Het
Zcwpw1 T G 5: 137,815,753 (GRCm39) Y419D possibly damaging Het
Zfp407 G A 18: 84,577,525 (GRCm39) A1196V possibly damaging Het
Zfp446 T A 7: 12,712,970 (GRCm39) S103T possibly damaging Het
Other mutations in Fen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02991:Fen1 UTSW 19 10,178,026 (GRCm39) missense probably benign
R3161:Fen1 UTSW 19 10,177,655 (GRCm39) missense probably damaging 0.96
R4245:Fen1 UTSW 19 10,177,731 (GRCm39) missense probably damaging 0.99
R5481:Fen1 UTSW 19 10,178,022 (GRCm39) missense probably damaging 1.00
R5553:Fen1 UTSW 19 10,177,787 (GRCm39) missense probably benign
R5733:Fen1 UTSW 19 10,178,022 (GRCm39) missense possibly damaging 0.86
R5783:Fen1 UTSW 19 10,178,194 (GRCm39) nonsense probably null
R6244:Fen1 UTSW 19 10,178,051 (GRCm39) missense probably damaging 1.00
R6498:Fen1 UTSW 19 10,177,479 (GRCm39) missense probably damaging 0.96
R6797:Fen1 UTSW 19 10,178,067 (GRCm39) missense probably benign 0.37
R8374:Fen1 UTSW 19 10,177,824 (GRCm39) missense probably benign 0.26
R9016:Fen1 UTSW 19 10,178,306 (GRCm39) missense probably damaging 1.00
R9719:Fen1 UTSW 19 10,178,016 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTGACCCCACTGCGAATTCG -3'
(R):5'- CGACACTTAACTGCCAGTGAG -3'

Sequencing Primer
(F):5'- GAATTCGCTCTTCAGAAAACTGC -3'
(R):5'- TGAGGCCAAGAAGCTGCC -3'
Posted On 2020-09-15