Incidental Mutation 'R7989:Olfr1211'
ID651629
Institutional Source Beutler Lab
Gene Symbol Olfr1211
Ensembl Gene ENSMUSG00000075112
Gene Nameolfactory receptor 1211
SynonymsMOR233-21, MOR233-16P, GA_x6K02T2Q125-50409367-50408432
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7989 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88926876-88938111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88929514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 267 (D267G)
Ref Sequence ENSEMBL: ENSMUSP00000150571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099808] [ENSMUST00000213412] [ENSMUST00000215205]
Predicted Effect probably damaging
Transcript: ENSMUST00000099808
AA Change: D267G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097396
Gene: ENSMUSG00000075112
AA Change: D267G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.5e-49 PFAM
Pfam:7tm_1 39 286 2.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213412
AA Change: D267G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215205
AA Change: D267G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Abcc12 T C 8: 86,505,479 T1317A probably benign Het
Abcc4 T C 14: 118,599,360 Q663R probably benign Het
Arhgef28 G A 13: 97,899,735 T1672I probably benign Het
Dnah3 A T 7: 120,077,789 D496E probably benign Het
Dse A T 10: 34,153,458 Y545* probably null Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam124b A T 1: 80,213,594 L24Q probably damaging Het
Fam180a A T 6: 35,315,338 N44K probably damaging Het
Gabrg3 G T 7: 56,724,641 N392K possibly damaging Het
Gm10471 A T 5: 26,085,645 L176Q probably damaging Het
Gprin2 G A 14: 34,194,704 R370* probably null Het
Grhpr C T 4: 44,989,008 P275S probably damaging Het
Hsf5 A G 11: 87,635,624 Q374R probably benign Het
Igtp A C 11: 58,206,379 K125N probably damaging Het
Il17a T C 1: 20,732,214 V49A possibly damaging Het
Klhl12 T C 1: 134,489,405 S552P probably benign Het
Olfr1175-ps T A 2: 88,322,820 N295I probably damaging Het
Pkd2l1 A T 19: 44,154,068 C512S probably benign Het
Plekha7 G A 7: 116,158,323 P464L probably benign Het
Plk5 A G 10: 80,364,065 R469G probably benign Het
Pphln1 C A 15: 93,489,079 H353N possibly damaging Het
Prkaa1 A G 15: 5,176,685 N341D probably damaging Het
Skp2 C T 15: 9,127,892 R129H probably benign Het
Slc5a6 A G 5: 31,042,136 probably null Het
Spata31d1b C T 13: 59,718,368 P1110L possibly damaging Het
Srgap2 A G 1: 131,298,432 S368P Het
Tiam2 G T 17: 3,518,249 E1557* probably null Het
Tmem200a C A 10: 25,994,057 V105F probably benign Het
Trbv3 A T 6: 41,048,642 K55N probably benign Het
Trio A G 15: 27,772,935 L1881P probably damaging Het
Unc13a G A 8: 71,652,273 R782W probably damaging Het
Usp32 A T 11: 85,034,300 M117K Het
Zfp655 T A 5: 145,244,570 C413S probably damaging Het
Other mutations in Olfr1211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Olfr1211 APN 2 88929448 missense probably damaging 1.00
IGL02936:Olfr1211 APN 2 88929784 missense probably benign 0.01
IGL02960:Olfr1211 APN 2 88929784 missense possibly damaging 0.80
IGL02989:Olfr1211 APN 2 88929704 missense possibly damaging 0.72
R0193:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R0413:Olfr1211 UTSW 2 88929562 missense probably benign 0.16
R1644:Olfr1211 UTSW 2 88929387 missense probably benign 0.01
R3715:Olfr1211 UTSW 2 88929413 missense probably benign 0.07
R4019:Olfr1211 UTSW 2 88929736 missense probably benign 0.02
R4722:Olfr1211 UTSW 2 88929980 missense possibly damaging 0.91
R4751:Olfr1211 UTSW 2 88929914 missense probably damaging 1.00
R4859:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R5053:Olfr1211 UTSW 2 88930253 missense probably benign 0.02
R6148:Olfr1211 UTSW 2 88930253 missense probably benign 0.00
R7064:Olfr1211 UTSW 2 88929509 missense probably benign 0.00
R7527:Olfr1211 UTSW 2 88930090 missense probably benign 0.00
R7584:Olfr1211 UTSW 2 88929805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTTGCTAGTGCCAGAC -3'
(R):5'- AACAGTGGGTCTATCTGCATC -3'

Sequencing Primer
(F):5'- GGTTTGCTAGTGCCAGACATAATC -3'
(R):5'- CAGTGGGTCTATCTGCATCATAATC -3'
Posted On2020-09-15