Incidental Mutation 'R7989:Zfp655'
ID651633
Institutional Source Beutler Lab
Gene Symbol Zfp655
Ensembl Gene ENSMUSG00000007812
Gene Namezinc finger protein 655
Synonyms9030409O18Rik, 2700038I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R7989 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145231715-145247302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145244570 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 413 (C413S)
Ref Sequence ENSEMBL: ENSMUSP00000128969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167316] [ENSMUST00000199322]
Predicted Effect probably damaging
Transcript: ENSMUST00000167316
AA Change: C413S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128969
Gene: ENSMUSG00000007812
AA Change: C413S

DomainStartEndE-ValueType
ZnF_C2H2 243 265 5.29e-5 SMART
ZnF_C2H2 271 293 2.99e-4 SMART
ZnF_C2H2 299 328 1.38e2 SMART
ZnF_C2H2 334 356 6.78e-3 SMART
ZnF_C2H2 361 383 3.99e0 SMART
ZnF_C2H2 411 433 3.63e-3 SMART
ZnF_C2H2 439 461 1.01e-1 SMART
low complexity region 463 475 N/A INTRINSIC
ZnF_C2H2 495 517 6.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein. The zinc finger proteins are involved in DNA binding and protein-protein interactions. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Abcc12 T C 8: 86,505,479 T1317A probably benign Het
Abcc4 T C 14: 118,599,360 Q663R probably benign Het
Arhgef28 G A 13: 97,899,735 T1672I probably benign Het
Dnah3 A T 7: 120,077,789 D496E probably benign Het
Dse A T 10: 34,153,458 Y545* probably null Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam124b A T 1: 80,213,594 L24Q probably damaging Het
Fam180a A T 6: 35,315,338 N44K probably damaging Het
Gabrg3 G T 7: 56,724,641 N392K possibly damaging Het
Gm10471 A T 5: 26,085,645 L176Q probably damaging Het
Gprin2 G A 14: 34,194,704 R370* probably null Het
Grhpr C T 4: 44,989,008 P275S probably damaging Het
Hsf5 A G 11: 87,635,624 Q374R probably benign Het
Igtp A C 11: 58,206,379 K125N probably damaging Het
Il17a T C 1: 20,732,214 V49A possibly damaging Het
Klhl12 T C 1: 134,489,405 S552P probably benign Het
Olfr1175-ps T A 2: 88,322,820 N295I probably damaging Het
Olfr1211 T C 2: 88,929,514 D267G probably damaging Het
Pkd2l1 A T 19: 44,154,068 C512S probably benign Het
Plekha7 G A 7: 116,158,323 P464L probably benign Het
Plk5 A G 10: 80,364,065 R469G probably benign Het
Pphln1 C A 15: 93,489,079 H353N possibly damaging Het
Prkaa1 A G 15: 5,176,685 N341D probably damaging Het
Skp2 C T 15: 9,127,892 R129H probably benign Het
Slc5a6 A G 5: 31,042,136 probably null Het
Spata31d1b C T 13: 59,718,368 P1110L possibly damaging Het
Srgap2 A G 1: 131,298,432 S368P Het
Tiam2 G T 17: 3,518,249 E1557* probably null Het
Tmem200a C A 10: 25,994,057 V105F probably benign Het
Trbv3 A T 6: 41,048,642 K55N probably benign Het
Trio A G 15: 27,772,935 L1881P probably damaging Het
Unc13a G A 8: 71,652,273 R782W probably damaging Het
Usp32 A T 11: 85,034,300 M117K Het
Other mutations in Zfp655
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Zfp655 APN 5 145244145 missense probably damaging 1.00
IGL01679:Zfp655 APN 5 145243827 missense probably damaging 0.96
IGL02379:Zfp655 APN 5 145243955 missense probably benign 0.13
IGL02647:Zfp655 APN 5 145243006 missense probably benign
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0104:Zfp655 UTSW 5 145244015 missense probably damaging 1.00
R0270:Zfp655 UTSW 5 145244457 missense probably damaging 1.00
R0608:Zfp655 UTSW 5 145244057 missense possibly damaging 0.57
R1528:Zfp655 UTSW 5 145244601 missense probably damaging 0.98
R2076:Zfp655 UTSW 5 145244600 missense possibly damaging 0.89
R2119:Zfp655 UTSW 5 145244784 missense probably damaging 0.98
R2375:Zfp655 UTSW 5 145244396 missense probably benign 0.10
R2403:Zfp655 UTSW 5 145244546 missense probably benign 0.00
R4032:Zfp655 UTSW 5 145244048 missense possibly damaging 0.50
R4532:Zfp655 UTSW 5 145244697 missense probably benign 0.06
R4880:Zfp655 UTSW 5 145244358 missense probably damaging 0.99
R5484:Zfp655 UTSW 5 145243635 missense probably benign 0.01
R5529:Zfp655 UTSW 5 145244736 missense probably damaging 0.96
R6193:Zfp655 UTSW 5 145244776 missense probably benign 0.03
R6195:Zfp655 UTSW 5 145243762 missense possibly damaging 0.52
R7050:Zfp655 UTSW 5 145244735 missense probably benign 0.12
R7471:Zfp655 UTSW 5 145244732 missense possibly damaging 0.80
R7612:Zfp655 UTSW 5 145237189 missense unknown
R7626:Zfp655 UTSW 5 145237107 missense probably damaging 1.00
R8557:Zfp655 UTSW 5 145244025 missense probably benign 0.37
R8805:Zfp655 UTSW 5 145244480 missense probably damaging 1.00
Z1176:Zfp655 UTSW 5 145244003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTTACTCAGCATCAGAG -3'
(R):5'- CAGAACTGTGACTGAAACTTTCCTC -3'

Sequencing Primer
(F):5'- TCAGAGAACACATAAGGACATGTC -3'
(R):5'- TGTGACTGAAACTTTCCTCATAATTG -3'
Posted On2020-09-15