Incidental Mutation 'R7989:Usp32'
ID 651646
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7989 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85034300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 117 (M117K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075] [ENSMUST00000172515]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000108075
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172515
SMART Domains Protein: ENSMUSP00000133781
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Blast:DUSP 1 52 7e-30 BLAST
low complexity region 53 65 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804
AA Change: M117K

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Abcc12 T C 8: 86,505,479 T1317A probably benign Het
Abcc4 T C 14: 118,599,360 Q663R probably benign Het
Arhgef28 G A 13: 97,899,735 T1672I probably benign Het
Dnah3 A T 7: 120,077,789 D496E probably benign Het
Dse A T 10: 34,153,458 Y545* probably null Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fam124b A T 1: 80,213,594 L24Q probably damaging Het
Fam180a A T 6: 35,315,338 N44K probably damaging Het
Gabrg3 G T 7: 56,724,641 N392K possibly damaging Het
Gm10471 A T 5: 26,085,645 L176Q probably damaging Het
Gprin2 G A 14: 34,194,704 R370* probably null Het
Grhpr C T 4: 44,989,008 P275S probably damaging Het
Hsf5 A G 11: 87,635,624 Q374R probably benign Het
Igtp A C 11: 58,206,379 K125N probably damaging Het
Il17a T C 1: 20,732,214 V49A possibly damaging Het
Klhl12 T C 1: 134,489,405 S552P probably benign Het
Olfr1175-ps T A 2: 88,322,820 N295I probably damaging Het
Olfr1211 T C 2: 88,929,514 D267G probably damaging Het
Pkd2l1 A T 19: 44,154,068 C512S probably benign Het
Plekha7 G A 7: 116,158,323 P464L probably benign Het
Plk5 A G 10: 80,364,065 R469G probably benign Het
Pphln1 C A 15: 93,489,079 H353N possibly damaging Het
Prkaa1 A G 15: 5,176,685 N341D probably damaging Het
Skp2 C T 15: 9,127,892 R129H probably benign Het
Slc5a6 A G 5: 31,042,136 probably null Het
Spata31d1b C T 13: 59,718,368 P1110L possibly damaging Het
Srgap2 A G 1: 131,298,432 S368P Het
Tiam2 G T 17: 3,518,249 E1557* probably null Het
Tmem200a C A 10: 25,994,057 V105F probably benign Het
Trbv3 A T 6: 41,048,642 K55N probably benign Het
Trio A G 15: 27,772,935 L1881P probably damaging Het
Unc13a G A 8: 71,652,273 R782W probably damaging Het
Zfp655 T A 5: 145,244,570 C413S probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
R9652:Usp32 UTSW 11 85030491 missense probably damaging 0.97
R9723:Usp32 UTSW 11 85044710 nonsense probably null
R9757:Usp32 UTSW 11 85077329 nonsense probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATCAGCAAGCATAGTGC -3'
(R):5'- ACAGTGTTCACTGTCTAACTAAACC -3'

Sequencing Primer
(F):5'- AATCGCCACTGTCCTAGGC -3'
(R):5'- CTAACTAAACCTTGTCTTTGGGG -3'
Posted On 2020-09-15