Mutagenetix > Incidental Mutation

Incidental Mutation 'R7990:Msh4'

651676

Institutional Source

Beutler Lab

Gene Symbol

Msh4

Ensembl Gene

ENSMUSG00000005493

Gene Name

mutS homolog 4

Synonyms

mMsh4, 4930485C04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.477) question?

Stock #

R7990 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153857149-153906138 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 153896892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 233 (M233K)

Ref Sequence

ENSEMBL: ENSMUSP00000005630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]

AlphaFold

Q99MT2

Predicted Effect

probably damaging
Transcript: ENSMUST00000005630
AA Change: M233K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: M233K

Domain	Start	End	E-Value	Type
low complexity region	91	107	N/A	INTRINSIC
Pfam:MutS_II	177	321	2.3e-20	PFAM
MUTSd	352	679	3.77e-37	SMART
MUTSac	695	888	1.6e-81	SMART
Blast:MUTSac	912	956	1e-9	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000188338
AA Change: M145K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: M145K

Domain	Start	End	E-Value	Type
Pfam:MutS_II	89	233	5.3e-19	PFAM
MUTSd	264	591	9.4e-40	SMART
MUTSac	607	800	4.2e-84	SMART
Blast:MUTSac	808	866	4e-17	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000190449
AA Change: M39K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: M39K

Domain	Start	End	E-Value	Type
Pfam:MutS_II	1	127	3.3e-15	PFAM
MUTSd	158	485	9.4e-40	SMART
MUTSac	501	694	4.2e-84	SMART
Blast:MUTSac	702	760	5e-17	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931417E11Rik	T	C	6: 73,469,545	Y7C	probably damaging	Het
4933434E20Rik	G	A	3: 90,063,242	V28I	probably damaging	Het
Abcd4	G	T	12: 84,604,388		probably null	Het
Alg2	T	C	4: 47,472,308	T167A	probably damaging	Het
Asap1	T	C	15: 64,172,737		probably null	Het
Atad5	T	A	11: 80,133,253	C1730*	probably null	Het
Atp8b1	T	C	18: 64,538,677	T1092A	possibly damaging	Het
C130050O18Rik	A	G	5: 139,414,917	T242A	probably benign	Het
Ccdc88c	A	G	12: 100,967,985	V211A	probably damaging	Het
Ccnl1	A	G	3: 65,946,893	S436P	possibly damaging	Het
Cgnl1	T	C	9: 71,725,265	E268G	probably damaging	Het
Clca4b	T	G	3: 144,928,342	D104A	probably damaging	Het
Col6a3	T	G	1: 90,781,855	K2480T	unknown	Het
Cryba1	T	C	11: 77,723,585	T21A	possibly damaging	Het
Csn1s1	C	T	5: 87,680,053	A259V	possibly damaging	Het
Dap3	A	C	3: 88,928,507	Y206*	probably null	Het
Etnppl	T	C	3: 130,630,659	I360T	possibly damaging	Het
Gal3st3	A	T	19: 5,302,589	M15L	probably benign	Het
Gdf5	A	G	2: 155,941,829	V401A	probably damaging	Het
Gm1110	A	G	9: 26,880,841	S628P	possibly damaging	Het
Gm9493	A	T	19: 23,620,033	I98F	possibly damaging	Het
Grin2a	T	C	16: 9,579,176	K1016E	possibly damaging	Het
Hdac9	T	C	12: 34,215,453	N850D	probably benign	Het
Itsn2	C	A	12: 4,635,629	L466I	unknown	Het
Kcnj16	C	A	11: 111,025,060	R183S	probably damaging	Het
Kcnk2	A	C	1: 189,209,905	L389R	probably damaging	Het
Kdm4c	A	C	4: 74,391,448	K949N	probably damaging	Het
Kif3b	G	A	2: 153,317,463	E395K	probably benign	Het
Ldlrad1	G	A	4: 107,209,491	A8T	probably benign	Het
Map3k1	A	T	13: 111,756,162	M853K	probably benign	Het
Metap1	T	G	3: 138,480,765	T68P	probably benign	Het
Mfsd11	T	C	11: 116,859,497	V114A	possibly damaging	Het
Mroh1	G	A	15: 76,452,275	R1566H	probably damaging	Het
Ncor1	T	G	11: 62,349,495		probably null	Het
Npl	A	T	1: 153,537,484	V29D	possibly damaging	Het
Olfr389	C	T	11: 73,776,671	V219I	probably benign	Het
Osmr	T	C	15: 6,852,467	I65M	possibly damaging	Het
Rabepk	C	T	2: 34,780,708	V247I	probably benign	Het
Rere	C	T	4: 150,614,870	P804S	unknown	Het
Rpgrip1	A	T	14: 52,129,518	Y265F	possibly damaging	Het
Slc10a1	T	C	12: 80,953,780	D315G	probably benign	Het
Smc5	A	T	19: 23,235,882	N555K	probably benign	Het
Spata17	T	A	1: 187,140,395	H26L	unknown	Het
Sphkap	C	T	1: 83,267,345	D1518N	probably damaging	Het
Sult2a6	A	T	7: 14,225,870	M246K	possibly damaging	Het
Tmx2	A	G	2: 84,676,136	F71L	probably damaging	Het
Ush2a	T	A	1: 188,542,799	L1823Q	probably benign	Het
Virma	T	A	4: 11,513,983	D612E	probably benign	Het
Wdfy4	A	T	14: 33,097,795	L1484Q		Het
Zan	A	G	5: 137,393,090	S4711P	unknown	Het
Zdhhc1	A	G	8: 105,476,369		probably null	Het
Zfp971	C	T	2: 178,033,568	T320I	probably damaging	Het

Other mutations in Msh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Msh4	APN	3	153883735	missense	possibly damaging	0.88
IGL01098:Msh4	APN	3	153877982	splice site	probably benign
IGL01609:Msh4	APN	3	153897397	missense	probably damaging	1.00
IGL01785:Msh4	APN	3	153857507	missense	probably damaging	1.00
IGL01939:Msh4	APN	3	153857589	missense	probably damaging	1.00
IGL02022:Msh4	APN	3	153886956	missense	probably damaging	1.00
IGL02209:Msh4	APN	3	153888862	missense	probably damaging	1.00
IGL02224:Msh4	APN	3	153890185	missense	possibly damaging	0.94
IGL02240:Msh4	APN	3	153873674	missense	probably damaging	0.98
IGL02493:Msh4	APN	3	153877908	critical splice donor site	probably null
IGL02576:Msh4	APN	3	153867746	missense	probably damaging	1.00
IGL02616:Msh4	APN	3	153857523	missense	probably benign
IGL02812:Msh4	APN	3	153901400	splice site	probably benign
IGL02888:Msh4	APN	3	153896913	nonsense	probably null
IGL02992:Msh4	APN	3	153872325	missense	possibly damaging	0.79
IGL03191:Msh4	APN	3	153869608	missense	probably damaging	0.97
P0021:Msh4	UTSW	3	153888818	missense	probably damaging	1.00
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0057:Msh4	UTSW	3	153869681	missense	probably benign	0.16
R0368:Msh4	UTSW	3	153888825	missense	probably damaging	1.00
R0377:Msh4	UTSW	3	153896890	missense	probably benign	0.00
R0631:Msh4	UTSW	3	153866420	missense	probably benign	0.02
R0632:Msh4	UTSW	3	153896895	missense	probably damaging	1.00
R0677:Msh4	UTSW	3	153879367	missense	possibly damaging	0.69
R0909:Msh4	UTSW	3	153863504	missense	probably benign	0.00
R1081:Msh4	UTSW	3	153872358	missense	probably benign	0.06
R1463:Msh4	UTSW	3	153857570	missense	probably damaging	1.00
R1476:Msh4	UTSW	3	153863384	missense	probably damaging	1.00
R1669:Msh4	UTSW	3	153876720	missense	possibly damaging	0.47
R1733:Msh4	UTSW	3	153867767	missense	probably damaging	1.00
R1859:Msh4	UTSW	3	153905880	missense	probably benign
R2168:Msh4	UTSW	3	153867835	nonsense	probably null
R2378:Msh4	UTSW	3	153863477	missense	probably damaging	0.99
R2991:Msh4	UTSW	3	153905860	missense	probably benign
R3025:Msh4	UTSW	3	153863491	missense	probably damaging	1.00
R4604:Msh4	UTSW	3	153872283	missense	probably damaging	1.00
R4757:Msh4	UTSW	3	153879387	missense	probably damaging	0.99
R5205:Msh4	UTSW	3	153866412	missense	probably damaging	1.00
R5285:Msh4	UTSW	3	153873713	missense	probably benign	0.03
R5766:Msh4	UTSW	3	153867840	missense	probably damaging	1.00
R5777:Msh4	UTSW	3	153863439	missense	probably benign	0.01
R5888:Msh4	UTSW	3	153867723	critical splice donor site	probably null
R7384:Msh4	UTSW	3	153888748	missense	probably benign	0.23
R7408:Msh4	UTSW	3	153876745	missense	probably benign	0.06
R7487:Msh4	UTSW	3	153863510	missense	probably damaging	1.00
R7503:Msh4	UTSW	3	153867750	missense	probably damaging	1.00
R7726:Msh4	UTSW	3	153866320	critical splice donor site	probably null
R8097:Msh4	UTSW	3	153877908	critical splice donor site	probably null
R8805:Msh4	UTSW	3	153857633	missense	probably benign	0.00
R8814:Msh4	UTSW	3	153872320	missense	probably damaging	1.00
R8861:Msh4	UTSW	3	153901468	missense	probably benign	0.04
R8970:Msh4	UTSW	3	153869732	nonsense	probably null
R9010:Msh4	UTSW	3	153890182	missense	probably benign	0.30
R9338:Msh4	UTSW	3	153867807	missense	possibly damaging	0.55
R9598:Msh4	UTSW	3	153901511	missense	possibly damaging	0.93
R9780:Msh4	UTSW	3	153876705	missense	probably damaging	1.00
Z1177:Msh4	UTSW	3	153879368	missense	probably benign	0.00
Z1177:Msh4	UTSW	3	153901443	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACAGACCAAGAGTACCCTGC -3'
(R):5'- GAGTAAAACATGACCTATCTTTCTGG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CTGTGCACTTCAACAGTTTA -3'

Posted On

2020-09-15