Incidental Mutation 'R7990:Gm1110'
ID651688
Institutional Source Beutler Lab
Gene Symbol Gm1110
Ensembl Gene ENSMUSG00000079644
Gene Namepredicted gene 1110
SynonymsLOC382064
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7990 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location26879567-26923111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26880841 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 628 (S628P)
Ref Sequence ENSEMBL: ENSMUSP00000110916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115261]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115261
AA Change: S628P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: S628P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 55 368 2e-93 PFAM
Pfam:Glyco_hydro_42 70 229 1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik T C 6: 73,469,545 Y7C probably damaging Het
4933434E20Rik G A 3: 90,063,242 V28I probably damaging Het
Alg2 T C 4: 47,472,308 T167A probably damaging Het
Atad5 T A 11: 80,133,253 C1730* probably null Het
Atp8b1 T C 18: 64,538,677 T1092A possibly damaging Het
C130050O18Rik A G 5: 139,414,917 T242A probably benign Het
Ccdc88c A G 12: 100,967,985 V211A probably damaging Het
Ccnl1 A G 3: 65,946,893 S436P possibly damaging Het
Cgnl1 T C 9: 71,725,265 E268G probably damaging Het
Clca4b T G 3: 144,928,342 D104A probably damaging Het
Col6a3 T G 1: 90,781,855 K2480T unknown Het
Cryba1 T C 11: 77,723,585 T21A possibly damaging Het
Csn1s1 C T 5: 87,680,053 A259V possibly damaging Het
Dap3 A C 3: 88,928,507 Y206* probably null Het
Etnppl T C 3: 130,630,659 I360T possibly damaging Het
Gal3st3 A T 19: 5,302,589 M15L probably benign Het
Gdf5 A G 2: 155,941,829 V401A probably damaging Het
Gm9493 A T 19: 23,620,033 I98F possibly damaging Het
Grin2a T C 16: 9,579,176 K1016E possibly damaging Het
Hdac9 T C 12: 34,215,453 N850D probably benign Het
Itsn2 C A 12: 4,635,629 L466I unknown Het
Kcnj16 C A 11: 111,025,060 R183S probably damaging Het
Kcnk2 A C 1: 189,209,905 L389R probably damaging Het
Kdm4c A C 4: 74,391,448 K949N probably damaging Het
Kif3b G A 2: 153,317,463 E395K probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Map3k1 A T 13: 111,756,162 M853K probably benign Het
Metap1 T G 3: 138,480,765 T68P probably benign Het
Mfsd11 T C 11: 116,859,497 V114A possibly damaging Het
Mroh1 G A 15: 76,452,275 R1566H probably damaging Het
Msh4 A T 3: 153,896,892 M233K probably damaging Het
Ncor1 T G 11: 62,349,495 probably null Het
Npl A T 1: 153,537,484 V29D possibly damaging Het
Olfr389 C T 11: 73,776,671 V219I probably benign Het
Osmr T C 15: 6,852,467 I65M possibly damaging Het
Rabepk C T 2: 34,780,708 V247I probably benign Het
Rere C T 4: 150,614,870 P804S unknown Het
Rpgrip1 A T 14: 52,129,518 Y265F possibly damaging Het
Slc10a1 T C 12: 80,953,780 D315G probably benign Het
Smc5 A T 19: 23,235,882 N555K probably benign Het
Spata17 T A 1: 187,140,395 H26L unknown Het
Sphkap C T 1: 83,267,345 D1518N probably damaging Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Tmx2 A G 2: 84,676,136 F71L probably damaging Het
Ush2a T A 1: 188,542,799 L1823Q probably benign Het
Virma T A 4: 11,513,983 D612E probably benign Het
Wdfy4 A T 14: 33,097,795 L1484Q Het
Zan A G 5: 137,393,090 S4711P unknown Het
Zdhhc1 A G 8: 105,476,369 probably null Het
Zfp971 C T 2: 178,033,568 T320I probably damaging Het
Other mutations in Gm1110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gm1110 APN 9 26880874 nonsense probably null
IGL01089:Gm1110 APN 9 26881860 missense probably benign
IGL01631:Gm1110 APN 9 26897916 critical splice donor site probably null
IGL02008:Gm1110 APN 9 26883230 missense probably benign 0.09
IGL02331:Gm1110 APN 9 26913287 critical splice donor site probably null
IGL02335:Gm1110 APN 9 26881763 missense probably benign 0.00
IGL02550:Gm1110 APN 9 26881834 missense probably benign 0.09
IGL02614:Gm1110 APN 9 26920714 missense probably benign 0.11
IGL03409:Gm1110 APN 9 26896620 missense probably benign 0.21
PIT4458001:Gm1110 UTSW 9 26880828 missense probably benign 0.00
R0189:Gm1110 UTSW 9 26883218 missense probably null 0.99
R0271:Gm1110 UTSW 9 26920666 missense probably damaging 1.00
R1034:Gm1110 UTSW 9 26921350 missense probably damaging 1.00
R1229:Gm1110 UTSW 9 26881806 missense probably benign
R1355:Gm1110 UTSW 9 26883761 missense probably benign 0.01
R1566:Gm1110 UTSW 9 26880870 missense probably damaging 1.00
R1574:Gm1110 UTSW 9 26881126 splice site probably benign
R1916:Gm1110 UTSW 9 26889638 missense probably damaging 1.00
R2011:Gm1110 UTSW 9 26894258 missense probably benign 0.01
R2214:Gm1110 UTSW 9 26902490 missense probably benign 0.37
R2567:Gm1110 UTSW 9 26920696 missense probably benign
R2967:Gm1110 UTSW 9 26881043 missense probably benign 0.05
R4271:Gm1110 UTSW 9 26895648 critical splice donor site probably null
R4683:Gm1110 UTSW 9 26920594 missense probably damaging 0.99
R4945:Gm1110 UTSW 9 26920595 missense possibly damaging 0.46
R5015:Gm1110 UTSW 9 26881866 missense probably benign 0.01
R5089:Gm1110 UTSW 9 26882387 missense probably damaging 0.96
R5225:Gm1110 UTSW 9 26902478 missense probably damaging 1.00
R5239:Gm1110 UTSW 9 26893570 missense probably benign 0.00
R5395:Gm1110 UTSW 9 26889632 missense probably benign
R5783:Gm1110 UTSW 9 26882336 missense probably benign
R6045:Gm1110 UTSW 9 26883209 critical splice donor site probably null
R6245:Gm1110 UTSW 9 26920747 missense probably benign 0.04
R6357:Gm1110 UTSW 9 26914128 splice site probably null
R6863:Gm1110 UTSW 9 26881064 missense probably damaging 1.00
R7336:Gm1110 UTSW 9 26914357 missense probably damaging 0.99
R7454:Gm1110 UTSW 9 26920649 missense probably benign
R7555:Gm1110 UTSW 9 26893628 missense probably benign 0.05
R7579:Gm1110 UTSW 9 26883826 missense possibly damaging 0.93
R8062:Gm1110 UTSW 9 26881821 missense probably damaging 0.99
R8108:Gm1110 UTSW 9 26920661 missense probably damaging 1.00
R8323:Gm1110 UTSW 9 26902423 critical splice donor site probably null
R8354:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8354:Gm1110 UTSW 9 26883281 missense probably benign 0.00
R8454:Gm1110 UTSW 9 26883280 missense probably benign 0.01
R8454:Gm1110 UTSW 9 26883281 missense probably benign 0.00
RF002:Gm1110 UTSW 9 26920640 missense probably damaging 1.00
X0063:Gm1110 UTSW 9 26894280 missense probably benign 0.01
Z1088:Gm1110 UTSW 9 26913310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAACACAGTGGGACCATCAG -3'
(R):5'- GAAACTGTCTTTGTCCCTGGC -3'

Sequencing Primer
(F):5'- CAAGCAGATTTCTGAGTTCAAGGCC -3'
(R):5'- GGCTCCTGGCTTCAACCTG -3'
Posted On2020-09-15