Incidental Mutation 'R7990:Smc5'
ID651708
Institutional Source Beutler Lab
Gene Symbol Smc5
Ensembl Gene ENSMUSG00000024943
Gene Namestructural maintenance of chromosomes 5
SynonymsSmc5l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7990 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location23206451-23273897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23235882 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 555 (N555K)
Ref Sequence ENSEMBL: ENSMUSP00000084837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087556] [ENSMUST00000223934] [ENSMUST00000226111]
Predicted Effect probably benign
Transcript: ENSMUST00000087556
AA Change: N555K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000084837
Gene: ENSMUSG00000024943
AA Change: N555K

DomainStartEndE-ValueType
Pfam:SMC_N 52 1057 9.2e-19 PFAM
Pfam:AAA_23 55 456 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223934
AA Change: N555K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226111
AA Change: N479K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout in embryonic stem cells causes abnormal mitosis, increased apoptosis and a shift from pluripotency to differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik T C 6: 73,469,545 Y7C probably damaging Het
4933434E20Rik G A 3: 90,063,242 V28I probably damaging Het
Alg2 T C 4: 47,472,308 T167A probably damaging Het
Atad5 T A 11: 80,133,253 C1730* probably null Het
Atp8b1 T C 18: 64,538,677 T1092A possibly damaging Het
C130050O18Rik A G 5: 139,414,917 T242A probably benign Het
Ccdc88c A G 12: 100,967,985 V211A probably damaging Het
Ccnl1 A G 3: 65,946,893 S436P possibly damaging Het
Cgnl1 T C 9: 71,725,265 E268G probably damaging Het
Clca4b T G 3: 144,928,342 D104A probably damaging Het
Col6a3 T G 1: 90,781,855 K2480T unknown Het
Cryba1 T C 11: 77,723,585 T21A possibly damaging Het
Csn1s1 C T 5: 87,680,053 A259V possibly damaging Het
Dap3 A C 3: 88,928,507 Y206* probably null Het
Etnppl T C 3: 130,630,659 I360T possibly damaging Het
Gal3st3 A T 19: 5,302,589 M15L probably benign Het
Gdf5 A G 2: 155,941,829 V401A probably damaging Het
Gm1110 A G 9: 26,880,841 S628P possibly damaging Het
Gm9493 A T 19: 23,620,033 I98F possibly damaging Het
Grin2a T C 16: 9,579,176 K1016E possibly damaging Het
Hdac9 T C 12: 34,215,453 N850D probably benign Het
Itsn2 C A 12: 4,635,629 L466I unknown Het
Kcnj16 C A 11: 111,025,060 R183S probably damaging Het
Kcnk2 A C 1: 189,209,905 L389R probably damaging Het
Kdm4c A C 4: 74,391,448 K949N probably damaging Het
Kif3b G A 2: 153,317,463 E395K probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Map3k1 A T 13: 111,756,162 M853K probably benign Het
Metap1 T G 3: 138,480,765 T68P probably benign Het
Mfsd11 T C 11: 116,859,497 V114A possibly damaging Het
Mroh1 G A 15: 76,452,275 R1566H probably damaging Het
Msh4 A T 3: 153,896,892 M233K probably damaging Het
Ncor1 T G 11: 62,349,495 probably null Het
Npl A T 1: 153,537,484 V29D possibly damaging Het
Olfr389 C T 11: 73,776,671 V219I probably benign Het
Osmr T C 15: 6,852,467 I65M possibly damaging Het
Rabepk C T 2: 34,780,708 V247I probably benign Het
Rere C T 4: 150,614,870 P804S unknown Het
Rpgrip1 A T 14: 52,129,518 Y265F possibly damaging Het
Slc10a1 T C 12: 80,953,780 D315G probably benign Het
Spata17 T A 1: 187,140,395 H26L unknown Het
Sphkap C T 1: 83,267,345 D1518N probably damaging Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Tmx2 A G 2: 84,676,136 F71L probably damaging Het
Ush2a T A 1: 188,542,799 L1823Q probably benign Het
Virma T A 4: 11,513,983 D612E probably benign Het
Wdfy4 A T 14: 33,097,795 L1484Q Het
Zan A G 5: 137,393,090 S4711P unknown Het
Zdhhc1 A G 8: 105,476,369 probably null Het
Zfp971 C T 2: 178,033,568 T320I probably damaging Het
Other mutations in Smc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Smc5 APN 19 23235965 missense probably damaging 1.00
IGL01070:Smc5 APN 19 23231601 missense possibly damaging 0.86
IGL01315:Smc5 APN 19 23231604 missense probably benign
IGL01879:Smc5 APN 19 23228184 missense probably damaging 0.97
IGL01902:Smc5 APN 19 23259768 missense possibly damaging 0.85
IGL02016:Smc5 APN 19 23273712 missense probably benign 0.00
IGL02186:Smc5 APN 19 23231859 missense probably damaging 1.00
IGL02383:Smc5 APN 19 23214632 splice site probably benign
IGL02447:Smc5 APN 19 23257492 missense probably benign 0.01
IGL02534:Smc5 APN 19 23228172 critical splice donor site probably null
IGL02834:Smc5 APN 19 23257604 missense probably benign 0.30
IGL03290:Smc5 APN 19 23273658 missense probably benign 0.19
R0722:Smc5 UTSW 19 23208927 missense probably damaging 0.99
R0893:Smc5 UTSW 19 23263653 missense possibly damaging 0.67
R0970:Smc5 UTSW 19 23238998 missense probably damaging 1.00
R1281:Smc5 UTSW 19 23235883 missense probably benign
R1368:Smc5 UTSW 19 23210443 missense probably damaging 1.00
R2092:Smc5 UTSW 19 23238899 missense probably benign
R3721:Smc5 UTSW 19 23210492 missense probably benign 0.21
R4382:Smc5 UTSW 19 23268846 missense probably benign 0.39
R4735:Smc5 UTSW 19 23242705 missense probably benign
R4936:Smc5 UTSW 19 23234003 missense probably damaging 1.00
R5306:Smc5 UTSW 19 23259645 critical splice donor site probably null
R5754:Smc5 UTSW 19 23244103 missense possibly damaging 0.92
R6175:Smc5 UTSW 19 23214170 missense possibly damaging 0.60
R6313:Smc5 UTSW 19 23208948 nonsense probably null
R6527:Smc5 UTSW 19 23228190 missense probably benign 0.00
R6611:Smc5 UTSW 19 23228919 missense probably benign 0.13
R6750:Smc5 UTSW 19 23242640 missense probably damaging 1.00
R6801:Smc5 UTSW 19 23214646 missense probably benign 0.34
R6821:Smc5 UTSW 19 23242787 missense probably benign 0.20
R7002:Smc5 UTSW 19 23231883 missense probably benign 0.00
R7198:Smc5 UTSW 19 23259700 nonsense probably null
R7386:Smc5 UTSW 19 23215175 missense possibly damaging 0.59
R7439:Smc5 UTSW 19 23242700 missense probably damaging 0.97
R7596:Smc5 UTSW 19 23214169 missense probably damaging 0.99
R7666:Smc5 UTSW 19 23229017 missense probably benign 0.15
R7760:Smc5 UTSW 19 23235890 missense probably benign 0.01
R8255:Smc5 UTSW 19 23208926 missense
R8359:Smc5 UTSW 19 23234079 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTGTTCCACAATTTGAAAGATCACC -3'
(R):5'- AATTTCTGACCACCCTAGCAATTCC -3'

Sequencing Primer
(F):5'- TGAAACATGAACATGCTACATGAC -3'
(R):5'- CCTAGCAATTCCAGTAGCAATATGG -3'
Posted On2020-09-15