Incidental Mutation 'R7991:Gm8251'
ID651710
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7991 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44059709 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 743 (H743L)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: H743L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: H743L

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A C 6: 40,928,510 probably null Het
Adamts19 A G 18: 59,052,654 D1200G probably damaging Het
Adnp2 A G 18: 80,129,322 L624P probably damaging Het
Ap2a2 A G 7: 141,609,847 Y249C probably damaging Het
Asxl2 A T 12: 3,484,531 N243Y probably damaging Het
Btnl4 A G 17: 34,474,283 S53P probably damaging Het
Caly T C 7: 140,071,600 D116G possibly damaging Het
Ccdc81 G A 7: 89,890,401 A209V probably benign Het
Cdc14a A G 3: 116,308,238 S347P probably benign Het
Cdh9 G T 15: 16,828,403 A194S probably damaging Het
Clca3a2 A G 3: 144,813,995 V206A probably benign Het
Clca4a A T 3: 144,952,739 V905E possibly damaging Het
Cluap1 A G 16: 3,928,621 E282G probably damaging Het
Cmtm2b T A 8: 104,329,787 C109* probably null Het
Crtac1 T C 19: 42,333,960 N114D probably benign Het
Dennd1b T C 1: 139,085,896 Y168H Het
Dock6 T C 9: 21,846,562 D82G probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fh1 T C 1: 175,609,771 Y254C probably damaging Het
Gm4881 G A 7: 24,928,550 P185S possibly damaging Het
Gm6588 G A 5: 112,450,925 R446H probably benign Het
H2-Q1 T A 17: 35,321,380 L147Q probably damaging Het
Hist1h3g T A 13: 23,535,717 M91K probably benign Het
Hnrnpu A T 1: 178,332,306 D403E unknown Het
Il34 T C 8: 110,749,490 K33E probably benign Het
Klhl20 A G 1: 161,106,864 V195A possibly damaging Het
Lair1 G T 7: 4,028,970 T46N probably damaging Het
Lama4 A G 10: 39,045,809 E442G possibly damaging Het
Lifr A T 15: 7,173,482 I400F possibly damaging Het
Man2a1 T C 17: 64,601,776 I14T probably benign Het
Olfr1427 A C 19: 12,098,826 V271G possibly damaging Het
Olfr1436 T A 19: 12,298,275 I286F probably damaging Het
Olfr282 T C 15: 98,437,538 I23T probably benign Het
Olfr51 T G 11: 51,007,244 S91A possibly damaging Het
Olfr573-ps1 A G 7: 102,942,553 L8P probably benign Het
Olfr62 T A 4: 118,666,292 C258* probably null Het
Papss2 G T 19: 32,652,003 V331F possibly damaging Het
Pcdha11 T C 18: 37,012,856 S667P probably damaging Het
Pcolce A T 5: 137,609,128 S75T probably benign Het
Phf20l1 A C 15: 66,630,919 D716A possibly damaging Het
Pkd1 A G 17: 24,572,621 E1094G possibly damaging Het
Ppm1h A G 10: 122,782,247 K104E probably benign Het
Ppp6r3 T C 19: 3,459,750 Y195C probably benign Het
Pramel6 T A 2: 87,509,687 L265Q probably benign Het
Prc1 A T 7: 80,312,221 N489I possibly damaging Het
Psg22 A C 7: 18,726,936 N497H probably damaging Het
Pum3 T A 19: 27,412,220 I411F possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l A T 10: 39,863,738 I2861L possibly damaging Het
Rsf1 A C 7: 97,661,333 K423N Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sept3 A G 15: 82,286,453 E216G probably benign Het
Sppl2c A G 11: 104,187,363 T330A probably benign Het
Sppl2c T C 11: 104,187,814 V480A possibly damaging Het
Srebf2 A G 15: 82,204,052 D1073G probably damaging Het
Sv2c C T 13: 96,088,289 V171M probably damaging Het
Tbc1d4 T A 14: 101,608,279 E61V probably damaging Het
Tnc T A 4: 64,008,746 T848S probably benign Het
Trmt5 A G 12: 73,282,665 Y240H probably damaging Het
Trpv1 T C 11: 73,241,757 V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 T59A unknown Het
Ubash3a T A 17: 31,237,895 L510M probably benign Het
Ubr3 T A 2: 69,952,856 I713N probably damaging Het
Upf3a A G 8: 13,792,166 E194G probably damaging Het
Usp22 A T 11: 61,174,762 Y42N probably benign Het
Vav3 T A 3: 109,563,162 C555S probably damaging Het
Vmn1r210 T A 13: 22,827,514 M201L probably benign Het
Wdr64 C A 1: 175,726,485 Q194K probably benign Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTCAACTGTCAAGTCTACTG -3'
(R):5'- TCCTATGCCCCAGAGAGAAG -3'

Sequencing Primer
(F):5'- CATGTCCTCTTTGTGTGTCA -3'
(R):5'- GGCACAGATATAACTTTGAAATCACG -3'
Posted On2020-09-15