Mutagenetix > Incidental Mutations

Incidental Mutation 'R7991:Ubr3'

651716

Institutional Source

Beutler Lab

Gene Symbol

Ubr3

Ensembl Gene

ENSMUSG00000044308

Gene Name

ubiquitin protein ligase E3 component n-recognin 3

Synonyms

Zfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7991 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69897246-70024013 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 69952856 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 713 (I713N)

Ref Sequence

ENSEMBL: ENSMUSP00000060159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055758
AA Change: I713N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: I713N

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	118	188	1.6e-19	PFAM
low complexity region	339	354	N/A	INTRINSIC
low complexity region	570	580	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
low complexity region	1082	1101	N/A	INTRINSIC
coiled coil region	1167	1199	N/A	INTRINSIC
Blast:RING	1289	1363	8e-39	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000112251
AA Change: I712N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: I712N

Domain	Start	End	E-Value	Type
low complexity region	13	40	N/A	INTRINSIC
low complexity region	67	88	N/A	INTRINSIC
Pfam:zf-UBR	119	187	1.7e-21	PFAM
low complexity region	338	353	N/A	INTRINSIC
low complexity region	569	579	N/A	INTRINSIC
low complexity region	1015	1026	N/A	INTRINSIC
low complexity region	1081	1100	N/A	INTRINSIC
coiled coil region	1166	1198	N/A	INTRINSIC
Blast:RING	1288	1362	8e-39	BLAST

Meta Mutation Damage Score

0.4045

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	C	6: 40,928,510		probably null	Het
Adamts19	A	G	18: 59,052,654	D1200G	probably damaging	Het
Adnp2	A	G	18: 80,129,322	L624P	probably damaging	Het
Akap9	A	G	5: 4,064,949		probably null	Het
Ap2a2	A	G	7: 141,609,847	Y249C	probably damaging	Het
Asxl2	A	T	12: 3,484,531	N243Y	probably damaging	Het
Btnl4	A	G	17: 34,474,283	S53P	probably damaging	Het
Caly	T	C	7: 140,071,600	D116G	possibly damaging	Het
Ccdc81	G	A	7: 89,890,401	A209V	probably benign	Het
Cdc14a	A	G	3: 116,308,238	S347P	probably benign	Het
Cdh9	G	T	15: 16,828,403	A194S	probably damaging	Het
Clca3a2	A	G	3: 144,813,995	V206A	probably benign	Het
Clca4a	A	T	3: 144,952,739	V905E	possibly damaging	Het
Cluap1	A	G	16: 3,928,621	E282G	probably damaging	Het
Cmtm2b	T	A	8: 104,329,787	C109*	probably null	Het
Crtac1	T	C	19: 42,333,960	N114D	probably benign	Het
Dennd1b	T	C	1: 139,085,896	Y168H		Het
Dock6	T	C	9: 21,846,562	D82G	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fh1	T	C	1: 175,609,771	Y254C	probably damaging	Het
Gm4881	G	A	7: 24,928,550	P185S	possibly damaging	Het
Gm6588	G	A	5: 112,450,925	R446H	probably benign	Het
Gm8251	T	A	1: 44,059,709	H743L	probably benign	Het
H2-Q1	T	A	17: 35,321,380	L147Q	probably damaging	Het
Hist1h3g	T	A	13: 23,535,717	M91K	probably benign	Het
Hnrnpu	A	T	1: 178,332,306	D403E	unknown	Het
Il34	T	C	8: 110,749,490	K33E	probably benign	Het
Klhl20	A	G	1: 161,106,864	V195A	possibly damaging	Het
Lair1	G	T	7: 4,028,970	T46N	probably damaging	Het
Lama4	A	G	10: 39,045,809	E442G	possibly damaging	Het
Lifr	A	T	15: 7,173,482	I400F	possibly damaging	Het
Man2a1	T	C	17: 64,601,776	I14T	probably benign	Het
Olfr1427	A	C	19: 12,098,826	V271G	possibly damaging	Het
Olfr1436	T	A	19: 12,298,275	I286F	probably damaging	Het
Olfr282	T	C	15: 98,437,538	I23T	probably benign	Het
Olfr51	T	G	11: 51,007,244	S91A	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,942,553	L8P	probably benign	Het
Olfr62	T	A	4: 118,666,292	C258*	probably null	Het
Papss2	G	T	19: 32,652,003	V331F	possibly damaging	Het
Pcdha11	T	C	18: 37,012,856	S667P	probably damaging	Het
Pcolce	A	T	5: 137,609,128	S75T	probably benign	Het
Phf20l1	A	C	15: 66,630,919	D716A	possibly damaging	Het
Pkd1	A	G	17: 24,572,621	E1094G	possibly damaging	Het
Ppm1h	A	G	10: 122,782,247	K104E	probably benign	Het
Ppp6r3	T	C	19: 3,459,750	Y195C	probably benign	Het
Pramel6	T	A	2: 87,509,687	L265Q	probably benign	Het
Prc1	A	T	7: 80,312,221	N489I	possibly damaging	Het
Psg22	A	C	7: 18,726,936	N497H	probably damaging	Het
Pum3	T	A	19: 27,412,220	I411F	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rev3l	A	T	10: 39,863,738	I2861L	possibly damaging	Het
Rsf1	A	C	7: 97,661,333	K423N		Het
Samd4b	A	G	7: 28,404,033	I553T	probably benign	Het
Sept3	A	G	15: 82,286,453	E216G	probably benign	Het
Sppl2c	A	G	11: 104,187,363	T330A	probably benign	Het
Sppl2c	T	C	11: 104,187,814	V480A	possibly damaging	Het
Srebf2	A	G	15: 82,204,052	D1073G	probably damaging	Het
Sv2c	C	T	13: 96,088,289	V171M	probably damaging	Het
Tbc1d4	T	A	14: 101,608,279	E61V	probably damaging	Het
Tnc	T	A	4: 64,008,746	T848S	probably benign	Het
Trmt5	A	G	12: 73,282,665	Y240H	probably damaging	Het
Trpv1	T	C	11: 73,241,757	V399A	possibly damaging	Het
Tstd2	T	C	4: 46,133,646	T59A	unknown	Het
Ubash3a	T	A	17: 31,237,895	L510M	probably benign	Het
Upf3a	A	G	8: 13,792,166	E194G	probably damaging	Het
Usp22	A	T	11: 61,174,762	Y42N	probably benign	Het
Vav3	T	A	3: 109,563,162	C555S	probably damaging	Het
Vmn1r210	T	A	13: 22,827,514	M201L	probably benign	Het
Wdr64	C	A	1: 175,726,485	Q194K	probably benign	Het

Other mutations in Ubr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ubr3	APN	2	69988810	missense	probably benign	0.40
IGL00985:Ubr3	APN	2	70003431	missense	probably damaging	1.00
IGL01061:Ubr3	APN	2	69983225	missense	probably benign	0.05
IGL01325:Ubr3	APN	2	69917097	missense	possibly damaging	0.71
IGL01398:Ubr3	APN	2	69959653	missense	probably damaging	1.00
IGL01484:Ubr3	APN	2	70021544	nonsense	probably null
IGL01599:Ubr3	APN	2	69938178	missense	probably damaging	1.00
IGL01616:Ubr3	APN	2	70020484	missense	probably benign	0.14
IGL01634:Ubr3	APN	2	69973572	missense	probably benign
IGL01684:Ubr3	APN	2	70016158	nonsense	probably null
IGL01810:Ubr3	APN	2	70003465	splice site	probably null
IGL01813:Ubr3	APN	2	69951570	missense	probably benign	0.34
IGL01994:Ubr3	APN	2	70021176	missense	probably damaging	1.00
IGL02188:Ubr3	APN	2	69959611	nonsense	probably null
IGL02318:Ubr3	APN	2	69979397	missense	probably damaging	1.00
IGL02379:Ubr3	APN	2	69948488	missense	possibly damaging	0.91
IGL02635:Ubr3	APN	2	70020483	missense	probably damaging	0.96
IGL02858:Ubr3	APN	2	69952859	missense	probably damaging	1.00
IGL03140:Ubr3	APN	2	69970189	missense	probably damaging	1.00
IGL03343:Ubr3	APN	2	69973146	splice site	probably benign
Hyrax	UTSW	2	69952868	missense	probably benign	0.32
manatee	UTSW	2	69979386	nonsense	probably null
sea_cow	UTSW	2	69959669	splice site	probably null
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0094:Ubr3	UTSW	2	69951362	missense	probably damaging	1.00
R0122:Ubr3	UTSW	2	69979412	missense	probably damaging	1.00
R0243:Ubr3	UTSW	2	69951405	missense	probably damaging	1.00
R0710:Ubr3	UTSW	2	69952837	missense	probably damaging	1.00
R0787:Ubr3	UTSW	2	69951421	splice site	probably benign
R1137:Ubr3	UTSW	2	69938315	splice site	probably benign
R1191:Ubr3	UTSW	2	70021181	nonsense	probably null
R1416:Ubr3	UTSW	2	69945071	missense	probably damaging	1.00
R1623:Ubr3	UTSW	2	69977723	nonsense	probably null
R1735:Ubr3	UTSW	2	70009129	missense	probably damaging	1.00
R1789:Ubr3	UTSW	2	70016367	missense	possibly damaging	0.87
R1793:Ubr3	UTSW	2	70000551	splice site	probably benign
R1932:Ubr3	UTSW	2	69953476	splice site	probably null
R2042:Ubr3	UTSW	2	69977774	nonsense	probably null
R2085:Ubr3	UTSW	2	69953764	missense	probably damaging	1.00
R2090:Ubr3	UTSW	2	69936017	missense	probably damaging	1.00
R2112:Ubr3	UTSW	2	69977792	missense	possibly damaging	0.73
R2173:Ubr3	UTSW	2	69897399	missense	probably benign
R2215:Ubr3	UTSW	2	69979317	critical splice acceptor site	probably null
R2273:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2274:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2275:Ubr3	UTSW	2	70016341	missense	probably benign	0.11
R2292:Ubr3	UTSW	2	69897260	unclassified	probably benign
R2447:Ubr3	UTSW	2	70003380	missense	probably damaging	1.00
R2504:Ubr3	UTSW	2	69938198	missense	probably damaging	0.99
R2517:Ubr3	UTSW	2	69936018	missense	probably damaging	1.00
R2901:Ubr3	UTSW	2	70016192	missense	possibly damaging	0.89
R3109:Ubr3	UTSW	2	69988840	missense	probably damaging	1.00
R3737:Ubr3	UTSW	2	69971234	critical splice donor site	probably null
R3793:Ubr3	UTSW	2	69917181	missense	possibly damaging	0.95
R3821:Ubr3	UTSW	2	69993813	critical splice donor site	probably null
R3918:Ubr3	UTSW	2	70016130	critical splice acceptor site	probably null
R4157:Ubr3	UTSW	2	69959669	splice site	probably null
R4235:Ubr3	UTSW	2	70016385	nonsense	probably null
R4276:Ubr3	UTSW	2	69938387	nonsense	probably null
R4544:Ubr3	UTSW	2	69956093	missense	probably benign	0.18
R4678:Ubr3	UTSW	2	69935919	missense	probably damaging	1.00
R4707:Ubr3	UTSW	2	69938370	intron	probably benign
R4785:Ubr3	UTSW	2	69959603	missense	probably damaging	1.00
R4872:Ubr3	UTSW	2	69970183	missense	probably damaging	1.00
R4887:Ubr3	UTSW	2	70013131	missense	probably damaging	0.99
R4920:Ubr3	UTSW	2	69952868	missense	probably benign	0.32
R4989:Ubr3	UTSW	2	70020446	splice site	probably benign
R5104:Ubr3	UTSW	2	69938256	missense	probably damaging	0.98
R5134:Ubr3	UTSW	2	70020446	splice site	probably benign
R5137:Ubr3	UTSW	2	69973335	missense	probably damaging	1.00
R5174:Ubr3	UTSW	2	70009162	missense	probably damaging	1.00
R5195:Ubr3	UTSW	2	69956034	missense	probably benign	0.00
R5437:Ubr3	UTSW	2	69944390	missense	probably damaging	1.00
R5539:Ubr3	UTSW	2	70020533	missense	probably damaging	1.00
R5781:Ubr3	UTSW	2	70016244	splice site	probably null
R5809:Ubr3	UTSW	2	69965511	missense	possibly damaging	0.90
R5913:Ubr3	UTSW	2	70021215	missense	probably damaging	1.00
R5969:Ubr3	UTSW	2	69979386	nonsense	probably null
R6136:Ubr3	UTSW	2	69993763	missense	probably benign	0.26
R6140:Ubr3	UTSW	2	69973329	missense	probably benign	0.09
R6185:Ubr3	UTSW	2	69938277	missense	probably damaging	0.98
R6220:Ubr3	UTSW	2	70020475	missense	probably damaging	1.00
R6258:Ubr3	UTSW	2	69982864	splice site	probably null
R6319:Ubr3	UTSW	2	69973414	missense	probably benign	0.00
R6322:Ubr3	UTSW	2	69956085	nonsense	probably null
R6470:Ubr3	UTSW	2	69965460	missense	probably benign	0.02
R6477:Ubr3	UTSW	2	69979429	nonsense	probably null
R6702:Ubr3	UTSW	2	69956049	missense	probably benign	0.23
R6709:Ubr3	UTSW	2	70013092	missense	probably damaging	1.00
R6803:Ubr3	UTSW	2	69936024	critical splice donor site	probably null
R6806:Ubr3	UTSW	2	69955964	splice site	probably benign
R6834:Ubr3	UTSW	2	70000481	missense	possibly damaging	0.63
R6841:Ubr3	UTSW	2	70020625	missense	probably damaging	1.00
R6847:Ubr3	UTSW	2	69983128	missense	probably damaging	1.00
R6889:Ubr3	UTSW	2	69944300	missense	possibly damaging	0.70
R7065:Ubr3	UTSW	2	69953705	missense	probably damaging	1.00
R7102:Ubr3	UTSW	2	69897822	missense	probably damaging	1.00
R7156:Ubr3	UTSW	2	70021623	missense	probably damaging	1.00
R7209:Ubr3	UTSW	2	70016134	missense	probably benign	0.01
R7273:Ubr3	UTSW	2	69979333	missense	probably damaging	0.97
R7314:Ubr3	UTSW	2	69991600	missense	probably damaging	1.00
R7422:Ubr3	UTSW	2	69953542	critical splice donor site	probably null
R7584:Ubr3	UTSW	2	69991503	missense	probably damaging	1.00
R7588:Ubr3	UTSW	2	69971169	missense	probably damaging	1.00
R7597:Ubr3	UTSW	2	69973468	missense	possibly damaging	0.69
R7697:Ubr3	UTSW	2	69897686	missense	probably damaging	1.00
R7737:Ubr3	UTSW	2	69991566	missense	probably benign	0.07
R7743:Ubr3	UTSW	2	69944449	missense	probably benign	0.28
R7946:Ubr3	UTSW	2	69951395	missense	possibly damaging	0.95
R8071:Ubr3	UTSW	2	69988876	missense	probably damaging	0.99
R8136:Ubr3	UTSW	2	70021179	missense	probably damaging	1.00
R8296:Ubr3	UTSW	2	69954362	missense	probably null	1.00
R8313:Ubr3	UTSW	2	69945134	missense	probably damaging	0.99
Z1088:Ubr3	UTSW	2	69922367	missense	probably benign	0.00
Z1177:Ubr3	UTSW	2	69897461	missense	probably benign	0.17
Z1177:Ubr3	UTSW	2	69897666	missense	probably damaging	1.00
Z1177:Ubr3	UTSW	2	69973206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTATCTAATGCTGAGCAGAATGC -3'
(R):5'- CTTCTACTTCCACAAGCCATGAG -3'

Sequencing Primer
(F):5'- GGCTAGTCTTGCTGAAATTC -3'
(R):5'- GCCCTTAATGAATCTAAGGCTGAGC -3'

Posted On

2020-09-15