Incidental Mutation 'R7991:Clca3a2'
ID 651720
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R7991 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144813995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 206 (V206A)
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929]
AlphaFold Q9EQR4
Predicted Effect probably benign
Transcript: ENSMUST00000029929
AA Change: V206A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262
AA Change: V206A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A C 6: 40,928,510 probably null Het
Adamts19 A G 18: 59,052,654 D1200G probably damaging Het
Adnp2 A G 18: 80,129,322 L624P probably damaging Het
Akap9 A G 5: 4,064,949 probably null Het
Ap2a2 A G 7: 141,609,847 Y249C probably damaging Het
Asxl2 A T 12: 3,484,531 N243Y probably damaging Het
Btnl4 A G 17: 34,474,283 S53P probably damaging Het
Caly T C 7: 140,071,600 D116G possibly damaging Het
Ccdc81 G A 7: 89,890,401 A209V probably benign Het
Cdc14a A G 3: 116,308,238 S347P probably benign Het
Cdh9 G T 15: 16,828,403 A194S probably damaging Het
Clca4a A T 3: 144,952,739 V905E possibly damaging Het
Cluap1 A G 16: 3,928,621 E282G probably damaging Het
Cmtm2b T A 8: 104,329,787 C109* probably null Het
Crtac1 T C 19: 42,333,960 N114D probably benign Het
Dennd1b T C 1: 139,085,896 Y168H Het
Dock6 T C 9: 21,846,562 D82G probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fh1 T C 1: 175,609,771 Y254C probably damaging Het
Gm4881 G A 7: 24,928,550 P185S possibly damaging Het
Gm6588 G A 5: 112,450,925 R446H probably benign Het
Gm8251 T A 1: 44,059,709 H743L probably benign Het
H2-Q1 T A 17: 35,321,380 L147Q probably damaging Het
Hist1h3g T A 13: 23,535,717 M91K probably benign Het
Hnrnpu A T 1: 178,332,306 D403E unknown Het
Il34 T C 8: 110,749,490 K33E probably benign Het
Klhl20 A G 1: 161,106,864 V195A possibly damaging Het
Lair1 G T 7: 4,028,970 T46N probably damaging Het
Lama4 A G 10: 39,045,809 E442G possibly damaging Het
Lifr A T 15: 7,173,482 I400F possibly damaging Het
Man2a1 T C 17: 64,601,776 I14T probably benign Het
Olfr1427 A C 19: 12,098,826 V271G possibly damaging Het
Olfr1436 T A 19: 12,298,275 I286F probably damaging Het
Olfr282 T C 15: 98,437,538 I23T probably benign Het
Olfr51 T G 11: 51,007,244 S91A possibly damaging Het
Olfr573-ps1 A G 7: 102,942,553 L8P probably benign Het
Olfr62 T A 4: 118,666,292 C258* probably null Het
Papss2 G T 19: 32,652,003 V331F possibly damaging Het
Pcdha11 T C 18: 37,012,856 S667P probably damaging Het
Pcolce A T 5: 137,609,128 S75T probably benign Het
Phf20l1 A C 15: 66,630,919 D716A possibly damaging Het
Pkd1 A G 17: 24,572,621 E1094G possibly damaging Het
Ppm1h A G 10: 122,782,247 K104E probably benign Het
Ppp6r3 T C 19: 3,459,750 Y195C probably benign Het
Pramel6 T A 2: 87,509,687 L265Q probably benign Het
Prc1 A T 7: 80,312,221 N489I possibly damaging Het
Psg22 A C 7: 18,726,936 N497H probably damaging Het
Pum3 T A 19: 27,412,220 I411F possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l A T 10: 39,863,738 I2861L possibly damaging Het
Rsf1 A C 7: 97,661,333 K423N Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sept3 A G 15: 82,286,453 E216G probably benign Het
Sppl2c A G 11: 104,187,363 T330A probably benign Het
Sppl2c T C 11: 104,187,814 V480A possibly damaging Het
Srebf2 A G 15: 82,204,052 D1073G probably damaging Het
Sv2c C T 13: 96,088,289 V171M probably damaging Het
Tbc1d4 T A 14: 101,608,279 E61V probably damaging Het
Tnc T A 4: 64,008,746 T848S probably benign Het
Trmt5 A G 12: 73,282,665 Y240H probably damaging Het
Trpv1 T C 11: 73,241,757 V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 T59A unknown Het
Ubash3a T A 17: 31,237,895 L510M probably benign Het
Ubr3 T A 2: 69,952,856 I713N probably damaging Het
Upf3a A G 8: 13,792,166 E194G probably damaging Het
Usp22 A T 11: 61,174,762 Y42N probably benign Het
Vav3 T A 3: 109,563,162 C555S probably damaging Het
Vmn1r210 T A 13: 22,827,514 M201L probably benign Het
Wdr64 C A 1: 175,726,485 Q194K probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCATTTTACACGCTTGGAG -3'
(R):5'- CCAATAGCAGTTGCCACAGAG -3'

Sequencing Primer
(F):5'- ACACGCTTGGAGGGTCATTGAG -3'
(R):5'- CAGTTGCCACAGAGAGATTTTAG -3'
Posted On 2020-09-15