Incidental Mutation 'R7991:Rsf1'
ID 651736
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms 4832420A03Rik, Hbxap, C030033M12Rik, XAP8, p325
MMRRC Submission 046032-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7991 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97229103-97341989 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 97310540 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 423 (K423N)
Ref Sequence ENSEMBL: ENSMUSP00000102771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107153] [ENSMUST00000123731]
AlphaFold E9PWW9
Predicted Effect
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623
AA Change: K423N

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123731
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,185,726 (GRCm39) D1200G probably damaging Het
Adnp2 A G 18: 80,172,537 (GRCm39) L624P probably damaging Het
Akap9 A G 5: 4,114,949 (GRCm39) probably null Het
Ap2a2 A G 7: 141,189,760 (GRCm39) Y249C probably damaging Het
Asxl2 A T 12: 3,534,531 (GRCm39) N243Y probably damaging Het
Btnl4 A G 17: 34,693,257 (GRCm39) S53P probably damaging Het
Caly T C 7: 139,651,513 (GRCm39) D116G possibly damaging Het
Ccdc121rt2 G A 5: 112,598,791 (GRCm39) R446H probably benign Het
Ccdc168 T A 1: 44,098,869 (GRCm39) H743L probably benign Het
Ccdc81 G A 7: 89,539,609 (GRCm39) A209V probably benign Het
Cdc14a A G 3: 116,101,887 (GRCm39) S347P probably benign Het
Cdh9 G T 15: 16,828,489 (GRCm39) A194S probably damaging Het
Clca3a2 A G 3: 144,519,756 (GRCm39) V206A probably benign Het
Clca4a A T 3: 144,658,500 (GRCm39) V905E possibly damaging Het
Cluap1 A G 16: 3,746,485 (GRCm39) E282G probably damaging Het
Cmtm2b T A 8: 105,056,419 (GRCm39) C109* probably null Het
Crtac1 T C 19: 42,322,399 (GRCm39) N114D probably benign Het
Dennd1b T C 1: 139,013,634 (GRCm39) Y168H Het
Dock6 T C 9: 21,757,858 (GRCm39) D82G probably damaging Het
Eps8 C T 6: 137,505,569 (GRCm39) R53Q possibly damaging Het
Erfl G A 7: 24,627,975 (GRCm39) P185S possibly damaging Het
Fh1 T C 1: 175,437,337 (GRCm39) Y254C probably damaging Het
H2-Q1 T A 17: 35,540,356 (GRCm39) L147Q probably damaging Het
H3c8 T A 13: 23,719,887 (GRCm39) M91K probably benign Het
Hnrnpu A T 1: 178,159,871 (GRCm39) D403E unknown Het
Il34 T C 8: 111,476,122 (GRCm39) K33E probably benign Het
Klhl20 A G 1: 160,934,434 (GRCm39) V195A possibly damaging Het
Lair1 G T 7: 4,031,969 (GRCm39) T46N probably damaging Het
Lama4 A G 10: 38,921,805 (GRCm39) E442G possibly damaging Het
Lifr A T 15: 7,202,963 (GRCm39) I400F possibly damaging Het
Man2a1 T C 17: 64,908,771 (GRCm39) I14T probably benign Het
Or13p10 T A 4: 118,523,489 (GRCm39) C258* probably null Het
Or1ad8 T G 11: 50,898,071 (GRCm39) S91A possibly damaging Het
Or4z4 A C 19: 12,076,190 (GRCm39) V271G possibly damaging Het
Or51h7 A G 7: 102,591,760 (GRCm39) L8P probably benign Het
Or5an10 T A 19: 12,275,639 (GRCm39) I286F probably damaging Het
Or8s10 T C 15: 98,335,419 (GRCm39) I23T probably benign Het
Papss2 G T 19: 32,629,403 (GRCm39) V331F possibly damaging Het
Pcdha11 T C 18: 37,145,909 (GRCm39) S667P probably damaging Het
Pcolce A T 5: 137,607,390 (GRCm39) S75T probably benign Het
Phf20l1 A C 15: 66,502,768 (GRCm39) D716A possibly damaging Het
Pkd1 A G 17: 24,791,595 (GRCm39) E1094G possibly damaging Het
Ppm1h A G 10: 122,618,152 (GRCm39) K104E probably benign Het
Ppp6r3 T C 19: 3,509,750 (GRCm39) Y195C probably benign Het
Pramel6 T A 2: 87,340,031 (GRCm39) L265Q probably benign Het
Prc1 A T 7: 79,961,969 (GRCm39) N489I possibly damaging Het
Prss59 A C 6: 40,905,444 (GRCm39) probably null Het
Psg22 A C 7: 18,460,861 (GRCm39) N497H probably damaging Het
Pum3 T A 19: 27,389,620 (GRCm39) I411F possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rev3l A T 10: 39,739,734 (GRCm39) I2861L possibly damaging Het
Samd4b A G 7: 28,103,458 (GRCm39) I553T probably benign Het
Septin3 A G 15: 82,170,654 (GRCm39) E216G probably benign Het
Sppl2c T C 11: 104,078,640 (GRCm39) V480A possibly damaging Het
Sppl2c A G 11: 104,078,189 (GRCm39) T330A probably benign Het
Srebf2 A G 15: 82,088,253 (GRCm39) D1073G probably damaging Het
Sv2c C T 13: 96,224,797 (GRCm39) V171M probably damaging Het
Tbc1d4 T A 14: 101,845,715 (GRCm39) E61V probably damaging Het
Tnc T A 4: 63,926,983 (GRCm39) T848S probably benign Het
Trmt5 A G 12: 73,329,439 (GRCm39) Y240H probably damaging Het
Trpv1 T C 11: 73,132,583 (GRCm39) V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 (GRCm39) T59A unknown Het
Ubash3a T A 17: 31,456,869 (GRCm39) L510M probably benign Het
Ubr3 T A 2: 69,783,200 (GRCm39) I713N probably damaging Het
Upf3a A G 8: 13,842,166 (GRCm39) E194G probably damaging Het
Usp22 A T 11: 61,065,588 (GRCm39) Y42N probably benign Het
Vav3 T A 3: 109,470,478 (GRCm39) C555S probably damaging Het
Vmn1r210 T A 13: 23,011,684 (GRCm39) M201L probably benign Het
Wdr64 C A 1: 175,554,051 (GRCm39) Q194K probably benign Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97,331,096 (GRCm39) critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97,334,791 (GRCm39) missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97,313,977 (GRCm39) critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97,310,782 (GRCm39) missense probably benign 0.00
IGL02487:Rsf1 APN 7 97,288,698 (GRCm39) missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97,310,434 (GRCm39) missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97,310,533 (GRCm39) missense probably benign 0.35
IGL03176:Rsf1 APN 7 97,328,357 (GRCm39) splice site probably benign
IGL03256:Rsf1 APN 7 97,328,211 (GRCm39) missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
BB014:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
BB018:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
FR4976:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
P0023:Rsf1 UTSW 7 97,311,478 (GRCm39) missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97,285,614 (GRCm39) missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97,229,112 (GRCm39) unclassified probably benign
R0392:Rsf1 UTSW 7 97,328,212 (GRCm39) missense probably benign 0.00
R0422:Rsf1 UTSW 7 97,330,024 (GRCm39) missense probably benign 0.04
R0584:Rsf1 UTSW 7 97,311,335 (GRCm39) missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97,311,226 (GRCm39) missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97,328,234 (GRCm39) missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97,229,174 (GRCm39) missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97,318,985 (GRCm39) missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1498:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1525:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1534:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1582:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1591:Rsf1 UTSW 7 97,288,520 (GRCm39) nonsense probably null
R1676:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1695:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1710:Rsf1 UTSW 7 97,311,556 (GRCm39) missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1764:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1823:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1864:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1884:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1897:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1915:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1928:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1958:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1996:Rsf1 UTSW 7 97,313,839 (GRCm39) missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2021:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2022:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R2046:Rsf1 UTSW 7 97,310,884 (GRCm39) missense probably benign 0.00
R2048:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2093:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2103:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2137:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2167:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2179:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2191:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2207:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2211:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2241:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2264:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2283:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2297:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2307:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2419:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2442:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2696:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R2764:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2939:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2965:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2972:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3008:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3013:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3026:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3110:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3147:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R3427:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3610:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R3624:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3753:Rsf1 UTSW 7 97,311,359 (GRCm39) missense probably benign 0.00
R3759:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3780:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3794:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3889:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R3925:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3964:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4037:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4084:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4240:Rsf1 UTSW 7 97,229,142 (GRCm39) unclassified probably benign
R4303:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R4383:Rsf1 UTSW 7 97,334,683 (GRCm39) missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4525:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R4530:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4543:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4632:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4633:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4652:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4675:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R4675:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R4677:Rsf1 UTSW 7 97,329,980 (GRCm39) missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4769:Rsf1 UTSW 7 97,325,429 (GRCm39) missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4820:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4917:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4979:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R5041:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R5125:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R5369:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R5371:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R5403:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R5436:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R5450:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R5532:Rsf1 UTSW 7 97,329,902 (GRCm39) missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97,311,328 (GRCm39) missense probably benign 0.02
R5657:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5689:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5745:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R5748:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R5773:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R5859:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6001:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6001:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6021:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6025:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6036:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6073:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6077:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6102:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6111:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6126:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6128:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6130:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6154:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6154:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6165:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6166:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6182:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6189:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6200:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6210:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6212:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6214:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6215:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6216:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6232:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6235:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6242:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6243:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6244:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6268:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6269:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6273:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6275:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R6286:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6291:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6293:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6297:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6302:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6309:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6312:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6324:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6343:Rsf1 UTSW 7 97,310,124 (GRCm39) missense probably benign 0.30
R6346:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6356:Rsf1 UTSW 7 97,311,141 (GRCm39) missense probably benign
R6370:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6378:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6394:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6398:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6406:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R6413:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6443:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6453:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R6471:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R6473:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6497:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6505:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6561:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6572:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6607:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6611:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6622:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6626:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6636:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6647:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6648:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6669:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6673:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R6679:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6685:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6695:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6697:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6726:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6739:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6747:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6751:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6771:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6773:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6787:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6800:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R6804:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6806:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6815:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6820:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6823:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6829:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6861:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6862:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6869:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6875:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6889:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6897:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6960:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6963:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6967:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6969:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6977:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6996:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7066:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7109:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7127:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R7138:Rsf1 UTSW 7 97,319,002 (GRCm39) missense
R7214:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R7217:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7238:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7246:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R7253:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7294:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7305:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7309:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7352:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7380:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7393:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7395:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7411:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7413:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7481:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7538:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7541:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7545:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7574:Rsf1 UTSW 7 97,310,374 (GRCm39) missense
R7578:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7599:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R7630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7632:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7710:Rsf1 UTSW 7 97,331,041 (GRCm39) missense
R7711:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7715:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7719:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7722:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7729:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7734:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7743:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7761:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7764:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7797:Rsf1 UTSW 7 97,310,692 (GRCm39) missense
R7802:Rsf1 UTSW 7 97,310,979 (GRCm39) missense
R7806:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7821:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7823:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R7824:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7825:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7826:Rsf1 UTSW 7 97,310,368 (GRCm39) unclassified probably benign
R7841:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R7854:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7862:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R7893:Rsf1 UTSW 7 97,311,165 (GRCm39) missense
R7923:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7924:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7927:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7931:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7951:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7957:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7960:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7979:Rsf1 UTSW 7 97,334,920 (GRCm39) missense
R7982:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R8028:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8030:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8042:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8062:Rsf1 UTSW 7 97,326,594 (GRCm39) missense
R8076:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8117:Rsf1 UTSW 7 97,288,464 (GRCm39) splice site probably null
R8132:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8153:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8155:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8166:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8197:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8235:Rsf1 UTSW 7 97,325,461 (GRCm39) utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R8282:Rsf1 UTSW 7 97,229,127 (GRCm39) frame shift probably null
R8301:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
R8315:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8343:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8370:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R8372:Rsf1 UTSW 7 97,311,624 (GRCm39) missense
R8376:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8382:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8392:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8410:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8443:Rsf1 UTSW 7 97,266,103 (GRCm39) missense
R8502:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8529:Rsf1 UTSW 7 97,320,074 (GRCm39) utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8554:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8558:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8735:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8742:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8772:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8862:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8866:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R8889:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8889:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8891:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8892:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8907:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8907:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R8913:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8916:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R8924:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8940:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8946:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8947:Rsf1 UTSW 7 97,331,059 (GRCm39) unclassified probably benign
R8951:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8975:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9033:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9044:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9060:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9066:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9079:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9080:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9094:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9096:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9101:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9102:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9123:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9125:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9126:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9128:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9157:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9159:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9161:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9187:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R9240:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9250:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9257:Rsf1 UTSW 7 97,334,918 (GRCm39) missense
R9288:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9345:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9406:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9411:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9414:Rsf1 UTSW 7 97,313,765 (GRCm39) critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R9421:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9423:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9427:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9448:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9452:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R9454:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9467:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R9468:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9483:Rsf1 UTSW 7 97,229,137 (GRCm39) unclassified probably benign
R9488:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R9502:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9507:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9509:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9519:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9526:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9581:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R9590:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9592:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9618:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9685:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9716:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9748:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9774:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9795:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9802:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
RF034:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
RF036:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
X0025:Rsf1 UTSW 7 97,285,651 (GRCm39) missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97,310,031 (GRCm39) nonsense probably null
Y4335:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGTAGCAACATCAAATCTCAAGAC -3'
(R):5'- ACCATTTCCCTCCATGCAGG -3'

Sequencing Primer
(F):5'- AGACATCATAGAGAAATCTACTGAGG -3'
(R):5'- AGGCATTTCCATCCTTAGCAGGG -3'
Posted On 2020-09-15