Incidental Mutation 'R7991:Trmt5'
ID651753
Institutional Source Beutler Lab
Gene Symbol Trmt5
Ensembl Gene ENSMUSG00000034442
Gene NameTRM5 tRNA methyltransferase 5
Synonyms2610027O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7991 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location73280011-73286710 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73282665 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 240 (Y240H)
Ref Sequence ENSEMBL: ENSMUSP00000112121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058139] [ENSMUST00000101313] [ENSMUST00000116420] [ENSMUST00000122920] [ENSMUST00000126488] [ENSMUST00000140523] [ENSMUST00000153941] [ENSMUST00000220701] [ENSMUST00000221189]
Predicted Effect probably benign
Transcript: ENSMUST00000058139
SMART Domains Protein: ENSMUSP00000057153
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101313
SMART Domains Protein: ENSMUSP00000098871
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 1 69 4.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116420
AA Change: Y240H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112121
Gene: ENSMUSG00000034442
AA Change: Y240H

DomainStartEndE-ValueType
Pfam:Met_10 191 412 4.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122920
SMART Domains Protein: ENSMUSP00000124386
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 113 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126488
SMART Domains Protein: ENSMUSP00000118374
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140523
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153941
SMART Domains Protein: ENSMUSP00000114870
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 124 1.6e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000220701
AA Change: Y3H
Predicted Effect probably benign
Transcript: ENSMUST00000221189
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 [PubMed 15248782]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A C 6: 40,928,510 probably null Het
Adamts19 A G 18: 59,052,654 D1200G probably damaging Het
Adnp2 A G 18: 80,129,322 L624P probably damaging Het
Ap2a2 A G 7: 141,609,847 Y249C probably damaging Het
Asxl2 A T 12: 3,484,531 N243Y probably damaging Het
Btnl4 A G 17: 34,474,283 S53P probably damaging Het
Caly T C 7: 140,071,600 D116G possibly damaging Het
Ccdc81 G A 7: 89,890,401 A209V probably benign Het
Cdc14a A G 3: 116,308,238 S347P probably benign Het
Cdh9 G T 15: 16,828,403 A194S probably damaging Het
Clca3a2 A G 3: 144,813,995 V206A probably benign Het
Clca4a A T 3: 144,952,739 V905E possibly damaging Het
Cluap1 A G 16: 3,928,621 E282G probably damaging Het
Cmtm2b T A 8: 104,329,787 C109* probably null Het
Crtac1 T C 19: 42,333,960 N114D probably benign Het
Dennd1b T C 1: 139,085,896 Y168H Het
Dock6 T C 9: 21,846,562 D82G probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fh1 T C 1: 175,609,771 Y254C probably damaging Het
Gm4881 G A 7: 24,928,550 P185S possibly damaging Het
Gm6588 G A 5: 112,450,925 R446H probably benign Het
Gm8251 T A 1: 44,059,709 H743L probably benign Het
H2-Q1 T A 17: 35,321,380 L147Q probably damaging Het
Hist1h3g T A 13: 23,535,717 M91K probably benign Het
Hnrnpu A T 1: 178,332,306 D403E unknown Het
Il34 T C 8: 110,749,490 K33E probably benign Het
Klhl20 A G 1: 161,106,864 V195A possibly damaging Het
Lair1 G T 7: 4,028,970 T46N probably damaging Het
Lama4 A G 10: 39,045,809 E442G possibly damaging Het
Lifr A T 15: 7,173,482 I400F possibly damaging Het
Man2a1 T C 17: 64,601,776 I14T probably benign Het
Olfr1427 A C 19: 12,098,826 V271G possibly damaging Het
Olfr1436 T A 19: 12,298,275 I286F probably damaging Het
Olfr282 T C 15: 98,437,538 I23T probably benign Het
Olfr51 T G 11: 51,007,244 S91A possibly damaging Het
Olfr573-ps1 A G 7: 102,942,553 L8P probably benign Het
Olfr62 T A 4: 118,666,292 C258* probably null Het
Papss2 G T 19: 32,652,003 V331F possibly damaging Het
Pcdha11 T C 18: 37,012,856 S667P probably damaging Het
Pcolce A T 5: 137,609,128 S75T probably benign Het
Phf20l1 A C 15: 66,630,919 D716A possibly damaging Het
Pkd1 A G 17: 24,572,621 E1094G possibly damaging Het
Ppm1h A G 10: 122,782,247 K104E probably benign Het
Ppp6r3 T C 19: 3,459,750 Y195C probably benign Het
Pramel6 T A 2: 87,509,687 L265Q probably benign Het
Prc1 A T 7: 80,312,221 N489I possibly damaging Het
Psg22 A C 7: 18,726,936 N497H probably damaging Het
Pum3 T A 19: 27,412,220 I411F possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l A T 10: 39,863,738 I2861L possibly damaging Het
Rsf1 A C 7: 97,661,333 K423N Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sept3 A G 15: 82,286,453 E216G probably benign Het
Sppl2c A G 11: 104,187,363 T330A probably benign Het
Sppl2c T C 11: 104,187,814 V480A possibly damaging Het
Srebf2 A G 15: 82,204,052 D1073G probably damaging Het
Sv2c C T 13: 96,088,289 V171M probably damaging Het
Tbc1d4 T A 14: 101,608,279 E61V probably damaging Het
Tnc T A 4: 64,008,746 T848S probably benign Het
Trpv1 T C 11: 73,241,757 V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 T59A unknown Het
Ubash3a T A 17: 31,237,895 L510M probably benign Het
Ubr3 T A 2: 69,952,856 I713N probably damaging Het
Upf3a A G 8: 13,792,166 E194G probably damaging Het
Usp22 A T 11: 61,174,762 Y42N probably benign Het
Vav3 T A 3: 109,563,162 C555S probably damaging Het
Vmn1r210 T A 13: 22,827,514 M201L probably benign Het
Wdr64 C A 1: 175,726,485 Q194K probably benign Het
Other mutations in Trmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Trmt5 APN 12 73284919 missense possibly damaging 0.80
IGL01468:Trmt5 APN 12 73281104 missense probably benign 0.08
IGL01681:Trmt5 APN 12 73282603 unclassified probably benign
IGL02502:Trmt5 APN 12 73281227 missense probably benign 0.06
IGL02627:Trmt5 APN 12 73281455 missense probably damaging 1.00
IGL02688:Trmt5 APN 12 73281458 nonsense probably null
IGL03390:Trmt5 APN 12 73282727 missense probably benign 0.30
IGL03391:Trmt5 APN 12 73281452 missense probably benign 0.00
R2068:Trmt5 UTSW 12 73284670 splice site probably null
R2239:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R2380:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R5169:Trmt5 UTSW 12 73282721 missense probably damaging 1.00
R5578:Trmt5 UTSW 12 73285063 splice site probably null
R5579:Trmt5 UTSW 12 73281652 missense possibly damaging 0.92
R7390:Trmt5 UTSW 12 73281620 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTCCATGGGCAATTTATTTC -3'
(R):5'- GTGGGTAGAATTACACATACCGAG -3'

Sequencing Primer
(F):5'- CCTCTTATAGTCTCTGTGAGCATAAG -3'
(R):5'- GGTAGAATTACACATACCGAGTACAG -3'
Posted On2020-09-15