Incidental Mutation 'R7991:Sept3'
ID651762
Institutional Source Beutler Lab
Gene Symbol Sept3
Ensembl Gene ENSMUSG00000022456
Gene Nameseptin 3
SynonymsB530002E20Rik, Sep3, 3110018K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7991 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82274893-82294574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82286453 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 216 (E216G)
Ref Sequence ENSEMBL: ENSMUSP00000112124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023095] [ENSMUST00000116423] [ENSMUST00000230365] [ENSMUST00000230418] [ENSMUST00000230507]
Predicted Effect probably benign
Transcript: ENSMUST00000023095
AA Change: E216G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023095
Gene: ENSMUSG00000022456
AA Change: E216G

DomainStartEndE-ValueType
Pfam:DUF258 27 143 9.1e-9 PFAM
Pfam:Septin 45 322 8.9e-117 PFAM
Pfam:AIG1 49 145 2.6e-7 PFAM
Pfam:MMR_HSR1 50 220 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116423
AA Change: E216G

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112124
Gene: ENSMUSG00000022456
AA Change: E216G

DomainStartEndE-ValueType
Pfam:Septin 45 322 1.2e-116 PFAM
Pfam:MMR_HSR1 50 195 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230365
AA Change: E216G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000230418
Predicted Effect possibly damaging
Transcript: ENSMUST00000230507
AA Change: E72G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A C 6: 40,928,510 probably null Het
Adamts19 A G 18: 59,052,654 D1200G probably damaging Het
Adnp2 A G 18: 80,129,322 L624P probably damaging Het
Ap2a2 A G 7: 141,609,847 Y249C probably damaging Het
Asxl2 A T 12: 3,484,531 N243Y probably damaging Het
Btnl4 A G 17: 34,474,283 S53P probably damaging Het
Caly T C 7: 140,071,600 D116G possibly damaging Het
Ccdc81 G A 7: 89,890,401 A209V probably benign Het
Cdc14a A G 3: 116,308,238 S347P probably benign Het
Cdh9 G T 15: 16,828,403 A194S probably damaging Het
Clca3a2 A G 3: 144,813,995 V206A probably benign Het
Clca4a A T 3: 144,952,739 V905E possibly damaging Het
Cluap1 A G 16: 3,928,621 E282G probably damaging Het
Cmtm2b T A 8: 104,329,787 C109* probably null Het
Crtac1 T C 19: 42,333,960 N114D probably benign Het
Dennd1b T C 1: 139,085,896 Y168H Het
Dock6 T C 9: 21,846,562 D82G probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fh1 T C 1: 175,609,771 Y254C probably damaging Het
Gm4881 G A 7: 24,928,550 P185S possibly damaging Het
Gm6588 G A 5: 112,450,925 R446H probably benign Het
Gm8251 T A 1: 44,059,709 H743L probably benign Het
H2-Q1 T A 17: 35,321,380 L147Q probably damaging Het
Hist1h3g T A 13: 23,535,717 M91K probably benign Het
Hnrnpu A T 1: 178,332,306 D403E unknown Het
Il34 T C 8: 110,749,490 K33E probably benign Het
Klhl20 A G 1: 161,106,864 V195A possibly damaging Het
Lair1 G T 7: 4,028,970 T46N probably damaging Het
Lama4 A G 10: 39,045,809 E442G possibly damaging Het
Lifr A T 15: 7,173,482 I400F possibly damaging Het
Man2a1 T C 17: 64,601,776 I14T probably benign Het
Olfr1427 A C 19: 12,098,826 V271G possibly damaging Het
Olfr1436 T A 19: 12,298,275 I286F probably damaging Het
Olfr282 T C 15: 98,437,538 I23T probably benign Het
Olfr51 T G 11: 51,007,244 S91A possibly damaging Het
Olfr573-ps1 A G 7: 102,942,553 L8P probably benign Het
Olfr62 T A 4: 118,666,292 C258* probably null Het
Papss2 G T 19: 32,652,003 V331F possibly damaging Het
Pcdha11 T C 18: 37,012,856 S667P probably damaging Het
Pcolce A T 5: 137,609,128 S75T probably benign Het
Phf20l1 A C 15: 66,630,919 D716A possibly damaging Het
Pkd1 A G 17: 24,572,621 E1094G possibly damaging Het
Ppm1h A G 10: 122,782,247 K104E probably benign Het
Ppp6r3 T C 19: 3,459,750 Y195C probably benign Het
Pramel6 T A 2: 87,509,687 L265Q probably benign Het
Prc1 A T 7: 80,312,221 N489I possibly damaging Het
Psg22 A C 7: 18,726,936 N497H probably damaging Het
Pum3 T A 19: 27,412,220 I411F possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l A T 10: 39,863,738 I2861L possibly damaging Het
Rsf1 A C 7: 97,661,333 K423N Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sppl2c A G 11: 104,187,363 T330A probably benign Het
Sppl2c T C 11: 104,187,814 V480A possibly damaging Het
Srebf2 A G 15: 82,204,052 D1073G probably damaging Het
Sv2c C T 13: 96,088,289 V171M probably damaging Het
Tbc1d4 T A 14: 101,608,279 E61V probably damaging Het
Tnc T A 4: 64,008,746 T848S probably benign Het
Trmt5 A G 12: 73,282,665 Y240H probably damaging Het
Trpv1 T C 11: 73,241,757 V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 T59A unknown Het
Ubash3a T A 17: 31,237,895 L510M probably benign Het
Ubr3 T A 2: 69,952,856 I713N probably damaging Het
Upf3a A G 8: 13,792,166 E194G probably damaging Het
Usp22 A T 11: 61,174,762 Y42N probably benign Het
Vav3 T A 3: 109,563,162 C555S probably damaging Het
Vmn1r210 T A 13: 22,827,514 M201L probably benign Het
Wdr64 C A 1: 175,726,485 Q194K probably benign Het
Other mutations in Sept3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Sept3 APN 15 82279613 unclassified probably benign
IGL01979:Sept3 APN 15 82284392 missense probably damaging 0.99
IGL03118:Sept3 APN 15 82284514 splice site probably null
R0478:Sept3 UTSW 15 82290806 missense probably damaging 1.00
R0556:Sept3 UTSW 15 82283765 unclassified probably benign
R3804:Sept3 UTSW 15 82286429 splice site probably benign
R3876:Sept3 UTSW 15 82285801 missense probably damaging 1.00
R4589:Sept3 UTSW 15 82285891 missense probably damaging 0.99
R4744:Sept3 UTSW 15 82290457 critical splice donor site probably null
R5954:Sept3 UTSW 15 82290427 missense probably damaging 1.00
R6434:Sept3 UTSW 15 82279603 missense possibly damaging 0.92
R7257:Sept3 UTSW 15 82289213 missense probably damaging 0.99
R7475:Sept3 UTSW 15 82286456 missense probably benign 0.00
R7641:Sept3 UTSW 15 82290782 missense probably damaging 1.00
R7754:Sept3 UTSW 15 82290773 missense probably benign 0.03
R7895:Sept3 UTSW 15 82285819 missense probably benign 0.00
RF020:Sept3 UTSW 15 82284461 missense probably damaging 1.00
X0065:Sept3 UTSW 15 82279504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGTCTTGAAGGAGAGCTG -3'
(R):5'- TCTGGGTTAGGTGACAGGAC -3'

Sequencing Primer
(F):5'- TCTTGAAGGAGAGCTGAGAGCC -3'
(R):5'- TGACAGGACAACGGCTTAC -3'
Posted On2020-09-15