Incidental Mutation 'R7991:Olfr1436'
ID651775
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Nameolfactory receptor 1436
SynonymsGA_x6K02T2RE5P-2634596-2633658, MOR214-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7991 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12298183-12299130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12298275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 286 (I286F)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
Predicted Effect probably damaging
Transcript: ENSMUST00000087812
AA Change: I286F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: I286F

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A C 6: 40,928,510 probably null Het
Adamts19 A G 18: 59,052,654 D1200G probably damaging Het
Adnp2 A G 18: 80,129,322 L624P probably damaging Het
Akap9 A G 5: 4,064,949 probably null Het
Ap2a2 A G 7: 141,609,847 Y249C probably damaging Het
Asxl2 A T 12: 3,484,531 N243Y probably damaging Het
Btnl4 A G 17: 34,474,283 S53P probably damaging Het
Caly T C 7: 140,071,600 D116G possibly damaging Het
Ccdc81 G A 7: 89,890,401 A209V probably benign Het
Cdc14a A G 3: 116,308,238 S347P probably benign Het
Cdh9 G T 15: 16,828,403 A194S probably damaging Het
Clca3a2 A G 3: 144,813,995 V206A probably benign Het
Clca4a A T 3: 144,952,739 V905E possibly damaging Het
Cluap1 A G 16: 3,928,621 E282G probably damaging Het
Cmtm2b T A 8: 104,329,787 C109* probably null Het
Crtac1 T C 19: 42,333,960 N114D probably benign Het
Dennd1b T C 1: 139,085,896 Y168H Het
Dock6 T C 9: 21,846,562 D82G probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fh1 T C 1: 175,609,771 Y254C probably damaging Het
Gm4881 G A 7: 24,928,550 P185S possibly damaging Het
Gm6588 G A 5: 112,450,925 R446H probably benign Het
Gm8251 T A 1: 44,059,709 H743L probably benign Het
H2-Q1 T A 17: 35,321,380 L147Q probably damaging Het
Hist1h3g T A 13: 23,535,717 M91K probably benign Het
Hnrnpu A T 1: 178,332,306 D403E unknown Het
Il34 T C 8: 110,749,490 K33E probably benign Het
Klhl20 A G 1: 161,106,864 V195A possibly damaging Het
Lair1 G T 7: 4,028,970 T46N probably damaging Het
Lama4 A G 10: 39,045,809 E442G possibly damaging Het
Lifr A T 15: 7,173,482 I400F possibly damaging Het
Man2a1 T C 17: 64,601,776 I14T probably benign Het
Olfr1427 A C 19: 12,098,826 V271G possibly damaging Het
Olfr282 T C 15: 98,437,538 I23T probably benign Het
Olfr51 T G 11: 51,007,244 S91A possibly damaging Het
Olfr573-ps1 A G 7: 102,942,553 L8P probably benign Het
Olfr62 T A 4: 118,666,292 C258* probably null Het
Papss2 G T 19: 32,652,003 V331F possibly damaging Het
Pcdha11 T C 18: 37,012,856 S667P probably damaging Het
Pcolce A T 5: 137,609,128 S75T probably benign Het
Phf20l1 A C 15: 66,630,919 D716A possibly damaging Het
Pkd1 A G 17: 24,572,621 E1094G possibly damaging Het
Ppm1h A G 10: 122,782,247 K104E probably benign Het
Ppp6r3 T C 19: 3,459,750 Y195C probably benign Het
Pramel6 T A 2: 87,509,687 L265Q probably benign Het
Prc1 A T 7: 80,312,221 N489I possibly damaging Het
Psg22 A C 7: 18,726,936 N497H probably damaging Het
Pum3 T A 19: 27,412,220 I411F possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l A T 10: 39,863,738 I2861L possibly damaging Het
Rsf1 A C 7: 97,661,333 K423N Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sept3 A G 15: 82,286,453 E216G probably benign Het
Sppl2c A G 11: 104,187,363 T330A probably benign Het
Sppl2c T C 11: 104,187,814 V480A possibly damaging Het
Srebf2 A G 15: 82,204,052 D1073G probably damaging Het
Sv2c C T 13: 96,088,289 V171M probably damaging Het
Tbc1d4 T A 14: 101,608,279 E61V probably damaging Het
Tnc T A 4: 64,008,746 T848S probably benign Het
Trmt5 A G 12: 73,282,665 Y240H probably damaging Het
Trpv1 T C 11: 73,241,757 V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 T59A unknown Het
Ubash3a T A 17: 31,237,895 L510M probably benign Het
Ubr3 T A 2: 69,952,856 I713N probably damaging Het
Upf3a A G 8: 13,792,166 E194G probably damaging Het
Usp22 A T 11: 61,174,762 Y42N probably benign Het
Vav3 T A 3: 109,563,162 C555S probably damaging Het
Vmn1r210 T A 13: 22,827,514 M201L probably benign Het
Wdr64 C A 1: 175,726,485 Q194K probably benign Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12298785 missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12298458 missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12298712 missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12299094 missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12298496 missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12298659 missense probably benign
R1648:Olfr1436 UTSW 19 12298659 missense probably benign
R1837:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R1899:Olfr1436 UTSW 19 12298343 missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12299087 missense probably benign 0.01
R4624:Olfr1436 UTSW 19 12298983 missense probably benign
R4681:Olfr1436 UTSW 19 12299049 missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12298941 missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12298580 missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12298896 missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12298776 missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12298789 missense probably damaging 0.99
R5560:Olfr1436 UTSW 19 12298644 nonsense probably null
R5983:Olfr1436 UTSW 19 12299103 missense probably benign 0.00
R6736:Olfr1436 UTSW 19 12298572 nonsense probably null
R6882:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R7465:Olfr1436 UTSW 19 12298437 missense probably benign 0.04
R7500:Olfr1436 UTSW 19 12298677 missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12298722 missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12298848 missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12298878 missense probably damaging 0.99
R7850:Olfr1436 UTSW 19 12298632 missense probably benign
R7956:Olfr1436 UTSW 19 12298302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCACAGTCCACATGGC -3'
(R):5'- GCACACGTAGAGCTTCTCATATTAAC -3'

Sequencing Primer
(F):5'- GTCACAGTCCACATGGCTATTATAAC -3'
(R):5'- ATTGTCTTGTCCATTCTGAAGATCAC -3'
Posted On2020-09-15