Mutagenetix > Incidental Mutations

Incidental Mutation 'R7991:Olfr1436'

651775

Institutional Source

Beutler Lab

Gene Symbol

Olfr1436

Ensembl Gene

ENSMUSG00000067513

Gene Name

olfactory receptor 1436

Synonyms

GA_x6K02T2RE5P-2634596-2633658, MOR214-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R7991 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12298183-12299130 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12298275 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 286 (I286F)

Ref Sequence

ENSEMBL: ENSMUSP00000085113 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087812]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087812
AA Change: I286F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: I286F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	35	311	2.4e-54	PFAM
Pfam:7tm_1	45	294	1.3e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	C	6: 40,928,510		probably null	Het
Adamts19	A	G	18: 59,052,654	D1200G	probably damaging	Het
Adnp2	A	G	18: 80,129,322	L624P	probably damaging	Het
Akap9	A	G	5: 4,064,949		probably null	Het
Ap2a2	A	G	7: 141,609,847	Y249C	probably damaging	Het
Asxl2	A	T	12: 3,484,531	N243Y	probably damaging	Het
Btnl4	A	G	17: 34,474,283	S53P	probably damaging	Het
Caly	T	C	7: 140,071,600	D116G	possibly damaging	Het
Ccdc81	G	A	7: 89,890,401	A209V	probably benign	Het
Cdc14a	A	G	3: 116,308,238	S347P	probably benign	Het
Cdh9	G	T	15: 16,828,403	A194S	probably damaging	Het
Clca3a2	A	G	3: 144,813,995	V206A	probably benign	Het
Clca4a	A	T	3: 144,952,739	V905E	possibly damaging	Het
Cluap1	A	G	16: 3,928,621	E282G	probably damaging	Het
Cmtm2b	T	A	8: 104,329,787	C109*	probably null	Het
Crtac1	T	C	19: 42,333,960	N114D	probably benign	Het
Dennd1b	T	C	1: 139,085,896	Y168H		Het
Dock6	T	C	9: 21,846,562	D82G	probably damaging	Het
Eps8	C	T	6: 137,528,571	R53Q	possibly damaging	Het
Fh1	T	C	1: 175,609,771	Y254C	probably damaging	Het
Gm4881	G	A	7: 24,928,550	P185S	possibly damaging	Het
Gm6588	G	A	5: 112,450,925	R446H	probably benign	Het
Gm8251	T	A	1: 44,059,709	H743L	probably benign	Het
H2-Q1	T	A	17: 35,321,380	L147Q	probably damaging	Het
Hist1h3g	T	A	13: 23,535,717	M91K	probably benign	Het
Hnrnpu	A	T	1: 178,332,306	D403E	unknown	Het
Il34	T	C	8: 110,749,490	K33E	probably benign	Het
Klhl20	A	G	1: 161,106,864	V195A	possibly damaging	Het
Lair1	G	T	7: 4,028,970	T46N	probably damaging	Het
Lama4	A	G	10: 39,045,809	E442G	possibly damaging	Het
Lifr	A	T	15: 7,173,482	I400F	possibly damaging	Het
Man2a1	T	C	17: 64,601,776	I14T	probably benign	Het
Olfr1427	A	C	19: 12,098,826	V271G	possibly damaging	Het
Olfr282	T	C	15: 98,437,538	I23T	probably benign	Het
Olfr51	T	G	11: 51,007,244	S91A	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,942,553	L8P	probably benign	Het
Olfr62	T	A	4: 118,666,292	C258*	probably null	Het
Papss2	G	T	19: 32,652,003	V331F	possibly damaging	Het
Pcdha11	T	C	18: 37,012,856	S667P	probably damaging	Het
Pcolce	A	T	5: 137,609,128	S75T	probably benign	Het
Phf20l1	A	C	15: 66,630,919	D716A	possibly damaging	Het
Pkd1	A	G	17: 24,572,621	E1094G	possibly damaging	Het
Ppm1h	A	G	10: 122,782,247	K104E	probably benign	Het
Ppp6r3	T	C	19: 3,459,750	Y195C	probably benign	Het
Pramel6	T	A	2: 87,509,687	L265Q	probably benign	Het
Prc1	A	T	7: 80,312,221	N489I	possibly damaging	Het
Psg22	A	C	7: 18,726,936	N497H	probably damaging	Het
Pum3	T	A	19: 27,412,220	I411F	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rev3l	A	T	10: 39,863,738	I2861L	possibly damaging	Het
Rsf1	A	C	7: 97,661,333	K423N		Het
Samd4b	A	G	7: 28,404,033	I553T	probably benign	Het
Sept3	A	G	15: 82,286,453	E216G	probably benign	Het
Sppl2c	A	G	11: 104,187,363	T330A	probably benign	Het
Sppl2c	T	C	11: 104,187,814	V480A	possibly damaging	Het
Srebf2	A	G	15: 82,204,052	D1073G	probably damaging	Het
Sv2c	C	T	13: 96,088,289	V171M	probably damaging	Het
Tbc1d4	T	A	14: 101,608,279	E61V	probably damaging	Het
Tnc	T	A	4: 64,008,746	T848S	probably benign	Het
Trmt5	A	G	12: 73,282,665	Y240H	probably damaging	Het
Trpv1	T	C	11: 73,241,757	V399A	possibly damaging	Het
Tstd2	T	C	4: 46,133,646	T59A	unknown	Het
Ubash3a	T	A	17: 31,237,895	L510M	probably benign	Het
Ubr3	T	A	2: 69,952,856	I713N	probably damaging	Het
Upf3a	A	G	8: 13,792,166	E194G	probably damaging	Het
Usp22	A	T	11: 61,174,762	Y42N	probably benign	Het
Vav3	T	A	3: 109,563,162	C555S	probably damaging	Het
Vmn1r210	T	A	13: 22,827,514	M201L	probably benign	Het
Wdr64	C	A	1: 175,726,485	Q194K	probably benign	Het

Other mutations in Olfr1436

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00975:Olfr1436	APN	19	12298785	missense	probably damaging	0.99
IGL02129:Olfr1436	APN	19	12298458	missense	probably damaging	1.00
PIT4378001:Olfr1436	UTSW	19	12298712	missense	probably damaging	1.00
R0727:Olfr1436	UTSW	19	12299094	missense	probably benign	0.03
R1244:Olfr1436	UTSW	19	12298496	missense	probably damaging	0.98
R1647:Olfr1436	UTSW	19	12298659	missense	probably benign
R1648:Olfr1436	UTSW	19	12298659	missense	probably benign
R1837:Olfr1436	UTSW	19	12298376	missense	probably damaging	1.00
R1899:Olfr1436	UTSW	19	12298343	missense	probably damaging	1.00
R2031:Olfr1436	UTSW	19	12298376	missense	probably damaging	1.00
R2305:Olfr1436	UTSW	19	12299087	missense	probably benign	0.01
R4624:Olfr1436	UTSW	19	12298983	missense	probably benign
R4681:Olfr1436	UTSW	19	12299049	missense	probably benign	0.05
R4790:Olfr1436	UTSW	19	12298941	missense	possibly damaging	0.60
R4865:Olfr1436	UTSW	19	12298580	missense	probably damaging	1.00
R4941:Olfr1436	UTSW	19	12298896	missense	possibly damaging	0.95
R5138:Olfr1436	UTSW	19	12298776	missense	possibly damaging	0.56
R5161:Olfr1436	UTSW	19	12298789	missense	probably damaging	0.99
R5560:Olfr1436	UTSW	19	12298644	nonsense	probably null
R5983:Olfr1436	UTSW	19	12299103	missense	probably benign	0.00
R6736:Olfr1436	UTSW	19	12298572	nonsense	probably null
R6882:Olfr1436	UTSW	19	12298570	missense	probably damaging	1.00
R6883:Olfr1436	UTSW	19	12298570	missense	probably damaging	1.00
R7465:Olfr1436	UTSW	19	12298437	missense	probably benign	0.04
R7500:Olfr1436	UTSW	19	12298677	missense	probably damaging	0.98
R7529:Olfr1436	UTSW	19	12298722	missense	probably damaging	1.00
R7565:Olfr1436	UTSW	19	12298848	missense	probably benign	0.09
R7611:Olfr1436	UTSW	19	12298878	missense	probably damaging	0.99
R7850:Olfr1436	UTSW	19	12298632	missense	probably benign
R7956:Olfr1436	UTSW	19	12298302	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTCACAGTCCACATGGC -3'
(R):5'- GCACACGTAGAGCTTCTCATATTAAC -3'

Sequencing Primer
(F):5'- GTCACAGTCCACATGGCTATTATAAC -3'
(R):5'- ATTGTCTTGTCCATTCTGAAGATCAC -3'

Posted On

2020-09-15