Incidental Mutation 'R7991:Papss2'
ID651777
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7991 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32652003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 331 (V331F)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025833
AA Change: V331F

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: V331F

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A C 6: 40,928,510 probably null Het
Adamts19 A G 18: 59,052,654 D1200G probably damaging Het
Adnp2 A G 18: 80,129,322 L624P probably damaging Het
Ap2a2 A G 7: 141,609,847 Y249C probably damaging Het
Asxl2 A T 12: 3,484,531 N243Y probably damaging Het
Btnl4 A G 17: 34,474,283 S53P probably damaging Het
Caly T C 7: 140,071,600 D116G possibly damaging Het
Ccdc81 G A 7: 89,890,401 A209V probably benign Het
Cdc14a A G 3: 116,308,238 S347P probably benign Het
Cdh9 G T 15: 16,828,403 A194S probably damaging Het
Clca3a2 A G 3: 144,813,995 V206A probably benign Het
Clca4a A T 3: 144,952,739 V905E possibly damaging Het
Cluap1 A G 16: 3,928,621 E282G probably damaging Het
Cmtm2b T A 8: 104,329,787 C109* probably null Het
Crtac1 T C 19: 42,333,960 N114D probably benign Het
Dennd1b T C 1: 139,085,896 Y168H Het
Dock6 T C 9: 21,846,562 D82G probably damaging Het
Eps8 C T 6: 137,528,571 R53Q possibly damaging Het
Fh1 T C 1: 175,609,771 Y254C probably damaging Het
Gm4881 G A 7: 24,928,550 P185S possibly damaging Het
Gm6588 G A 5: 112,450,925 R446H probably benign Het
Gm8251 T A 1: 44,059,709 H743L probably benign Het
H2-Q1 T A 17: 35,321,380 L147Q probably damaging Het
Hist1h3g T A 13: 23,535,717 M91K probably benign Het
Hnrnpu A T 1: 178,332,306 D403E unknown Het
Il34 T C 8: 110,749,490 K33E probably benign Het
Klhl20 A G 1: 161,106,864 V195A possibly damaging Het
Lair1 G T 7: 4,028,970 T46N probably damaging Het
Lama4 A G 10: 39,045,809 E442G possibly damaging Het
Lifr A T 15: 7,173,482 I400F possibly damaging Het
Man2a1 T C 17: 64,601,776 I14T probably benign Het
Olfr1427 A C 19: 12,098,826 V271G possibly damaging Het
Olfr1436 T A 19: 12,298,275 I286F probably damaging Het
Olfr282 T C 15: 98,437,538 I23T probably benign Het
Olfr51 T G 11: 51,007,244 S91A possibly damaging Het
Olfr573-ps1 A G 7: 102,942,553 L8P probably benign Het
Olfr62 T A 4: 118,666,292 C258* probably null Het
Pcdha11 T C 18: 37,012,856 S667P probably damaging Het
Pcolce A T 5: 137,609,128 S75T probably benign Het
Phf20l1 A C 15: 66,630,919 D716A possibly damaging Het
Pkd1 A G 17: 24,572,621 E1094G possibly damaging Het
Ppm1h A G 10: 122,782,247 K104E probably benign Het
Ppp6r3 T C 19: 3,459,750 Y195C probably benign Het
Pramel6 T A 2: 87,509,687 L265Q probably benign Het
Prc1 A T 7: 80,312,221 N489I possibly damaging Het
Psg22 A C 7: 18,726,936 N497H probably damaging Het
Pum3 T A 19: 27,412,220 I411F possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rev3l A T 10: 39,863,738 I2861L possibly damaging Het
Rsf1 A C 7: 97,661,333 K423N Het
Samd4b A G 7: 28,404,033 I553T probably benign Het
Sept3 A G 15: 82,286,453 E216G probably benign Het
Sppl2c A G 11: 104,187,363 T330A probably benign Het
Sppl2c T C 11: 104,187,814 V480A possibly damaging Het
Srebf2 A G 15: 82,204,052 D1073G probably damaging Het
Sv2c C T 13: 96,088,289 V171M probably damaging Het
Tbc1d4 T A 14: 101,608,279 E61V probably damaging Het
Tnc T A 4: 64,008,746 T848S probably benign Het
Trmt5 A G 12: 73,282,665 Y240H probably damaging Het
Trpv1 T C 11: 73,241,757 V399A possibly damaging Het
Tstd2 T C 4: 46,133,646 T59A unknown Het
Ubash3a T A 17: 31,237,895 L510M probably benign Het
Ubr3 T A 2: 69,952,856 I713N probably damaging Het
Upf3a A G 8: 13,792,166 E194G probably damaging Het
Usp22 A T 11: 61,174,762 Y42N probably benign Het
Vav3 T A 3: 109,563,162 C555S probably damaging Het
Vmn1r210 T A 13: 22,827,514 M201L probably benign Het
Wdr64 C A 1: 175,726,485 Q194K probably benign Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 splice site probably null
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTGGCCTTGGGTCAGAAGA -3'
(R):5'- CCTATAAATACAAGTGTACCTCCCT -3'

Sequencing Primer
(F):5'- GGAGGACTGTACACATCTTAGCC -3'
(R):5'- CCTTGCAAAGGTTTTGTACT -3'
Posted On2020-09-15