Incidental Mutation 'R7992:Nckap5'
ID 651780
Institutional Source Beutler Lab
Gene Symbol Nckap5
Ensembl Gene ENSMUSG00000049690
Gene Name NCK-associated protein 5
Synonyms LOC380609, D130011D22Rik, E030049G20Rik
MMRRC Submission 046033-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 125841373-126758529 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125954547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 668 (N668K)
Ref Sequence ENSEMBL: ENSMUSP00000125624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000161954] [ENSMUST00000162877]
AlphaFold E9QAE1
Predicted Effect possibly damaging
Transcript: ENSMUST00000057846
AA Change: N604K

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690
AA Change: N604K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112583
AA Change: N736K

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690
AA Change: N736K

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161954
AA Change: N668K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690
AA Change: N668K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,904 (GRCm39) T1054A probably benign Het
Ankfn1 A C 11: 89,413,859 (GRCm39) I172S probably benign Het
Ano3 T C 2: 110,605,367 (GRCm39) T280A possibly damaging Het
Arhgef37 T A 18: 61,638,827 (GRCm39) E307D probably benign Het
Bptf C T 11: 107,001,709 (GRCm39) V468I probably benign Het
Ces1b A G 8: 93,786,987 (GRCm39) V464A probably benign Het
Cmc2 A T 8: 117,616,446 (GRCm39) L93* probably null Het
Ddx60 A G 8: 62,407,569 (GRCm39) D360G probably benign Het
Dock6 C T 9: 21,744,135 (GRCm39) probably null Het
Erp44 A G 4: 48,218,136 (GRCm39) F178L possibly damaging Het
Fam47e T C 5: 92,722,541 (GRCm39) V79A probably damaging Het
Fancd2 T C 6: 113,542,165 (GRCm39) S770P probably damaging Het
Fcgr1 A G 3: 96,191,897 (GRCm39) F304L probably benign Het
Fkbp15 T C 4: 62,230,538 (GRCm39) E725G probably damaging Het
Fn1 T C 1: 71,638,825 (GRCm39) I1971V probably benign Het
Gdf6 A G 4: 9,844,652 (GRCm39) S59G probably benign Het
Gm5773 T A 3: 93,680,373 (GRCm39) I15N possibly damaging Het
Hesx1 T C 14: 26,723,379 (GRCm39) S70P probably benign Het
Htr5a T C 5: 28,055,995 (GRCm39) S329P probably damaging Het
Htt T C 5: 34,987,225 (GRCm39) probably null Het
Iba57 T A 11: 59,052,288 (GRCm39) M118L unknown Het
Ifi35 C T 11: 101,348,307 (GRCm39) Q112* probably null Het
Il12rb1 G T 8: 71,265,233 (GRCm39) R183L possibly damaging Het
Il12rb2 A T 6: 67,328,311 (GRCm39) Y306* probably null Het
Ints1 C G 5: 139,742,282 (GRCm39) D1722H probably damaging Het
Ipp T G 4: 116,381,453 (GRCm39) D317E probably damaging Het
Kif26a A G 12: 112,142,481 (GRCm39) T912A probably benign Het
Klhdc7a A G 4: 139,693,045 (GRCm39) V634A probably damaging Het
Klhl40 C A 9: 121,607,748 (GRCm39) P303T probably damaging Het
Krt13 T C 11: 100,008,478 (GRCm39) T420A unknown Het
Lpcat2 T C 8: 93,582,186 (GRCm39) F35S probably damaging Het
Macf1 A G 4: 123,289,753 (GRCm39) V5470A probably damaging Het
Mta2 T C 19: 8,925,151 (GRCm39) probably null Het
Muc16 G T 9: 18,567,725 (GRCm39) T1598K unknown Het
Nlrp4a A T 7: 26,150,070 (GRCm39) D559V possibly damaging Het
Npat T C 9: 53,474,167 (GRCm39) L653P probably benign Het
Oog1 G A 12: 87,655,252 (GRCm39) V467I possibly damaging Het
Or4c15b A G 2: 89,113,082 (GRCm39) S132P probably benign Het
Or4f56 C T 2: 111,703,280 (GRCm39) A307T probably benign Het
Pdzph1 T A 17: 59,186,105 (GRCm39) M1229L possibly damaging Het
Piwil4 T A 9: 14,614,445 (GRCm39) Q106L Het
Plekha5 C A 6: 140,472,267 (GRCm39) R65S probably damaging Het
Ptger4 T C 15: 5,264,381 (GRCm39) Y425C probably damaging Het
Pus7 A G 5: 23,951,465 (GRCm39) M534T possibly damaging Het
Rtkn2 C T 10: 67,875,923 (GRCm39) P411S probably damaging Het
Scand1 G A 2: 156,154,232 (GRCm39) P13S unknown Het
Scaper T C 9: 55,765,438 (GRCm39) H550R probably benign Het
Senp5 T A 16: 31,796,514 (GRCm39) K617I probably damaging Het
Shq1 A G 6: 100,613,972 (GRCm39) L282P probably damaging Het
Slc12a6 T A 2: 112,166,256 (GRCm39) C227S probably damaging Het
Slc5a9 T A 4: 111,747,729 (GRCm39) T284S probably benign Het
Stat2 T A 10: 128,120,831 (GRCm39) F579L probably damaging Het
Tes G T 6: 17,096,242 (GRCm39) A77S possibly damaging Het
Themis A T 10: 28,637,342 (GRCm39) T149S probably benign Het
Tmprss6 C T 15: 78,326,664 (GRCm39) R653H probably benign Het
Trmt6 G A 2: 132,652,959 (GRCm39) L107F probably damaging Het
Trpm6 T C 19: 18,792,714 (GRCm39) C713R probably damaging Het
Trpm7 T C 2: 126,667,454 (GRCm39) I820V probably benign Het
Usp45 G A 4: 21,824,543 (GRCm39) A432T probably benign Het
Xab2 A T 8: 3,668,622 (GRCm39) V82E possibly damaging Het
Zfp938 T A 10: 82,061,777 (GRCm39) Y281F possibly damaging Het
Other mutations in Nckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nckap5 APN 1 125,954,889 (GRCm39) missense probably damaging 0.99
IGL00956:Nckap5 APN 1 125,952,755 (GRCm39) missense probably damaging 0.98
IGL01414:Nckap5 APN 1 126,456,450 (GRCm39) missense probably damaging 1.00
IGL01482:Nckap5 APN 1 125,950,897 (GRCm39) missense probably damaging 1.00
IGL01508:Nckap5 APN 1 125,953,309 (GRCm39) missense probably damaging 0.96
IGL02071:Nckap5 APN 1 125,909,305 (GRCm39) missense probably damaging 0.97
IGL02129:Nckap5 APN 1 125,955,432 (GRCm39) nonsense probably null
IGL02821:Nckap5 APN 1 125,955,553 (GRCm39) missense probably damaging 1.00
IGL03174:Nckap5 APN 1 125,909,383 (GRCm39) missense probably damaging 1.00
F5493:Nckap5 UTSW 1 125,953,564 (GRCm39) missense probably benign
G5030:Nckap5 UTSW 1 125,953,591 (GRCm39) missense probably damaging 0.96
R0033:Nckap5 UTSW 1 125,867,979 (GRCm39) intron probably benign
R0164:Nckap5 UTSW 1 125,952,144 (GRCm39) missense possibly damaging 0.84
R0164:Nckap5 UTSW 1 125,952,144 (GRCm39) missense possibly damaging 0.84
R0349:Nckap5 UTSW 1 125,954,171 (GRCm39) missense probably benign
R0482:Nckap5 UTSW 1 125,954,102 (GRCm39) missense possibly damaging 0.92
R0508:Nckap5 UTSW 1 125,909,121 (GRCm39) splice site probably null
R0541:Nckap5 UTSW 1 126,623,459 (GRCm39) missense possibly damaging 0.82
R0609:Nckap5 UTSW 1 125,955,025 (GRCm39) nonsense probably null
R0701:Nckap5 UTSW 1 125,953,094 (GRCm39) missense probably benign 0.06
R0782:Nckap5 UTSW 1 125,909,278 (GRCm39) missense probably damaging 1.00
R1389:Nckap5 UTSW 1 125,954,447 (GRCm39) missense probably damaging 0.99
R1401:Nckap5 UTSW 1 125,942,398 (GRCm39) splice site probably benign
R1436:Nckap5 UTSW 1 125,953,798 (GRCm39) missense possibly damaging 0.96
R1506:Nckap5 UTSW 1 125,953,650 (GRCm39) nonsense probably null
R1528:Nckap5 UTSW 1 125,952,659 (GRCm39) missense possibly damaging 0.68
R1942:Nckap5 UTSW 1 125,952,039 (GRCm39) missense probably damaging 1.00
R1968:Nckap5 UTSW 1 125,942,367 (GRCm39) missense probably damaging 0.99
R2055:Nckap5 UTSW 1 125,954,635 (GRCm39) missense probably damaging 1.00
R2105:Nckap5 UTSW 1 125,954,255 (GRCm39) missense probably damaging 1.00
R2214:Nckap5 UTSW 1 125,953,487 (GRCm39) missense possibly damaging 0.77
R2311:Nckap5 UTSW 1 126,456,489 (GRCm39) missense probably damaging 1.00
R2403:Nckap5 UTSW 1 125,955,146 (GRCm39) missense probably benign 0.18
R2430:Nckap5 UTSW 1 125,842,494 (GRCm39) missense probably damaging 0.99
R2914:Nckap5 UTSW 1 125,954,274 (GRCm39) splice site probably null
R3782:Nckap5 UTSW 1 125,952,811 (GRCm39) missense possibly damaging 0.93
R4133:Nckap5 UTSW 1 126,150,443 (GRCm39) missense probably benign 0.13
R4249:Nckap5 UTSW 1 125,955,376 (GRCm39) missense probably benign 0.01
R4448:Nckap5 UTSW 1 125,953,463 (GRCm39) nonsense probably null
R4456:Nckap5 UTSW 1 125,842,472 (GRCm39) unclassified probably benign
R4682:Nckap5 UTSW 1 126,030,279 (GRCm39) critical splice donor site probably null
R4817:Nckap5 UTSW 1 125,954,952 (GRCm39) missense possibly damaging 0.68
R4907:Nckap5 UTSW 1 125,953,889 (GRCm39) missense possibly damaging 0.92
R4908:Nckap5 UTSW 1 125,955,324 (GRCm39) missense probably damaging 1.00
R4924:Nckap5 UTSW 1 125,954,765 (GRCm39) nonsense probably null
R4926:Nckap5 UTSW 1 126,456,378 (GRCm39) intron probably benign
R5032:Nckap5 UTSW 1 125,904,786 (GRCm39) missense possibly damaging 0.62
R5133:Nckap5 UTSW 1 125,961,697 (GRCm39) missense probably benign 0.01
R5197:Nckap5 UTSW 1 126,150,410 (GRCm39) missense possibly damaging 0.79
R5238:Nckap5 UTSW 1 125,955,461 (GRCm39) missense probably damaging 0.96
R5257:Nckap5 UTSW 1 125,952,245 (GRCm39) missense probably damaging 0.99
R5277:Nckap5 UTSW 1 125,954,277 (GRCm39) nonsense probably null
R5512:Nckap5 UTSW 1 125,955,481 (GRCm39) missense possibly damaging 0.63
R5700:Nckap5 UTSW 1 125,904,662 (GRCm39) critical splice donor site probably null
R5789:Nckap5 UTSW 1 125,955,439 (GRCm39) missense probably damaging 1.00
R6029:Nckap5 UTSW 1 125,953,523 (GRCm39) missense possibly damaging 0.89
R6249:Nckap5 UTSW 1 125,952,667 (GRCm39) missense probably benign
R6292:Nckap5 UTSW 1 125,842,752 (GRCm39) missense probably damaging 0.99
R6521:Nckap5 UTSW 1 126,309,909 (GRCm39) missense probably damaging 1.00
R6875:Nckap5 UTSW 1 125,950,931 (GRCm39) missense probably benign 0.03
R7017:Nckap5 UTSW 1 126,030,398 (GRCm39) missense probably damaging 1.00
R7018:Nckap5 UTSW 1 125,952,785 (GRCm39) missense probably damaging 0.99
R7054:Nckap5 UTSW 1 126,186,449 (GRCm39) splice site probably null
R7204:Nckap5 UTSW 1 125,954,104 (GRCm39) missense probably benign
R7336:Nckap5 UTSW 1 125,953,786 (GRCm39) missense probably benign 0.00
R7544:Nckap5 UTSW 1 125,953,948 (GRCm39) missense possibly damaging 0.92
R7590:Nckap5 UTSW 1 125,954,270 (GRCm39) missense probably benign 0.00
R7684:Nckap5 UTSW 1 125,954,594 (GRCm39) missense probably benign 0.00
R7749:Nckap5 UTSW 1 125,952,383 (GRCm39) missense probably damaging 1.00
R7773:Nckap5 UTSW 1 125,954,581 (GRCm39) missense probably benign 0.00
R7813:Nckap5 UTSW 1 125,953,163 (GRCm39) missense probably benign 0.10
R7970:Nckap5 UTSW 1 125,952,758 (GRCm39) nonsense probably null
R8278:Nckap5 UTSW 1 125,955,509 (GRCm39) missense probably damaging 1.00
R8373:Nckap5 UTSW 1 125,954,032 (GRCm39) missense probably benign 0.02
R8414:Nckap5 UTSW 1 125,942,357 (GRCm39) missense probably damaging 1.00
R8755:Nckap5 UTSW 1 125,954,279 (GRCm39) missense possibly damaging 0.89
R8845:Nckap5 UTSW 1 125,909,423 (GRCm39) missense possibly damaging 0.80
R9016:Nckap5 UTSW 1 126,623,491 (GRCm39) start codon destroyed probably null 0.01
R9209:Nckap5 UTSW 1 125,867,928 (GRCm39) missense unknown
R9214:Nckap5 UTSW 1 125,942,376 (GRCm39) missense probably benign 0.01
R9300:Nckap5 UTSW 1 125,909,423 (GRCm39) nonsense probably null
R9464:Nckap5 UTSW 1 125,952,494 (GRCm39) missense probably benign 0.00
R9572:Nckap5 UTSW 1 125,955,454 (GRCm39) missense probably benign 0.41
R9721:Nckap5 UTSW 1 125,955,017 (GRCm39) missense probably damaging 0.98
R9748:Nckap5 UTSW 1 125,953,939 (GRCm39) missense probably damaging 1.00
Z1088:Nckap5 UTSW 1 125,952,569 (GRCm39) missense possibly damaging 0.76
Z1176:Nckap5 UTSW 1 126,456,418 (GRCm39) critical splice donor site probably null
Z1177:Nckap5 UTSW 1 126,150,396 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGTGGGCATAGACTCCAC -3'
(R):5'- TCACTGTCACCAGGGATGAAATTTC -3'

Sequencing Primer
(F):5'- TGGGCATAGACTCCACAAGTTTG -3'
(R):5'- GGGATGAAATTTCCATCAGCTCAGC -3'
Posted On 2020-09-15