Incidental Mutation 'R7992:Ano3'
ID 651782
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110775022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 280 (T280A)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: T280A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: T280A

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
R9376:Ano3 UTSW 2 110666437 missense probably damaging 1.00
R9588:Ano3 UTSW 2 110697997 missense possibly damaging 0.91
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGAGTCTCCAAGTGTGAG -3'
(R):5'- GGTAGGTATCTATCACCTGGAATC -3'

Sequencing Primer
(F):5'- GTTCCCTGTAACTGGAGTCACAG -3'
(R):5'- TGACTTTGTTCCAGGGTA -3'
Posted On 2020-09-15