Incidental Mutation 'R7992:Olfr1305'
ID 651783
Institutional Source Beutler Lab
Gene Symbol Olfr1305
Ensembl Gene ENSMUSG00000074955
Gene Name olfactory receptor 1305
Synonyms MOR245-8, GA_x6K02T2Q125-72930843-72929905
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111867657-111877149 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 111872935 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 307 (A307T)
Ref Sequence ENSEMBL: ENSMUSP00000149215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099608] [ENSMUST00000213405] [ENSMUST00000213737]
AlphaFold A2AVW3
Predicted Effect probably benign
Transcript: ENSMUST00000099608
AA Change: A307T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097203
Gene: ENSMUSG00000074955
AA Change: A307T

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-41 PFAM
Pfam:7TM_GPCR_Srsx 35 302 6.8e-7 PFAM
Pfam:7tm_1 41 287 4.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213405
AA Change: A307T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213737
AA Change: A307T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Olfr1305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr1305 APN 2 111872950 missense probably benign 0.03
IGL02198:Olfr1305 APN 2 111873248 missense probably damaging 1.00
IGL02277:Olfr1305 APN 2 111873580 missense possibly damaging 0.91
IGL02302:Olfr1305 APN 2 111873542 missense possibly damaging 0.76
IGL03348:Olfr1305 APN 2 111873148 missense probably damaging 0.99
PIT4131001:Olfr1305 UTSW 2 111873304 missense probably benign 0.02
R2144:Olfr1305 UTSW 2 111873423 missense probably damaging 0.96
R2860:Olfr1305 UTSW 2 111873473 nonsense probably null
R2861:Olfr1305 UTSW 2 111873473 nonsense probably null
R3785:Olfr1305 UTSW 2 111873486 missense probably damaging 0.99
R4474:Olfr1305 UTSW 2 111873439 missense possibly damaging 0.52
R4508:Olfr1305 UTSW 2 111873602 missense probably damaging 1.00
R4540:Olfr1305 UTSW 2 111873201 missense probably damaging 1.00
R4783:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4784:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4785:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R5410:Olfr1305 UTSW 2 111873292 missense probably damaging 1.00
R5491:Olfr1305 UTSW 2 111873562 missense probably benign 0.44
R6875:Olfr1305 UTSW 2 111872961 missense possibly damaging 0.92
R7185:Olfr1305 UTSW 2 111873822 missense possibly damaging 0.89
R9100:Olfr1305 UTSW 2 111873261 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CAGAACAGCTTGAAACTGGTAC -3'
(R):5'- GATGTTCATCCAAGGCCCTTTC -3'

Sequencing Primer
(F):5'- GGCACAGTTATTTAAGGATTAAAAGG -3'
(R):5'- ACTCTGTTGGCTCATATTACAGTTG -3'
Posted On 2020-09-15