Incidental Mutation 'R7992:Fcgr1'
ID651789
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene NameFc receptor, IgG, high affinity I
SynonymsCD64, FcgammaRI
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R7992 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96282909-96293969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96284581 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 304 (F304L)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
Predicted Effect probably benign
Transcript: ENSMUST00000029748
AA Change: F304L

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: F304L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96284370 missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96284577 missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96284498 nonsense probably null
F5770:Fcgr1 UTSW 3 96284276 makesense probably null
FR4737:Fcgr1 UTSW 3 96284504 frame shift probably null
FR4737:Fcgr1 UTSW 3 96287094 missense probably benign 0.01
R0323:Fcgr1 UTSW 3 96285829 missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96292312 missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96292366 missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96285868 missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96285917 missense possibly damaging 0.88
R3941:Fcgr1 UTSW 3 96286033 missense probably benign 0.13
R4004:Fcgr1 UTSW 3 96284352 missense probably benign 0.00
R4409:Fcgr1 UTSW 3 96284577 missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96286986 missense probably damaging 0.99
R5047:Fcgr1 UTSW 3 96285884 missense probably benign 0.38
R6970:Fcgr1 UTSW 3 96284620 critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96284299 missense not run
R8554:Fcgr1 UTSW 3 96292472 missense probably damaging 1.00
V7581:Fcgr1 UTSW 3 96284276 makesense probably null
V7582:Fcgr1 UTSW 3 96284276 makesense probably null
V7583:Fcgr1 UTSW 3 96284276 makesense probably null
X0028:Fcgr1 UTSW 3 96286027 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACTGAGCTTCGAGGTCCATC -3'
(R):5'- ACCATGGTCTCTAAGTTCAGGAG -3'

Sequencing Primer
(F):5'- GCTCGCAGTGGCTGTTAC -3'
(R):5'- CTAAGTTCAGGAGTGACATTCCC -3'
Posted On2020-09-15