Incidental Mutation 'R7992:Usp45'
ID 651791
Institutional Source Beutler Lab
Gene Symbol Usp45
Ensembl Gene ENSMUSG00000040455
Gene Name ubiquitin specific petidase 45
Synonyms Gcap7, 3110003C05Rik, 4930550B20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 21767156-21837872 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21824543 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 432 (A432T)
Ref Sequence ENSEMBL: ENSMUSP00000048324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040429] [ENSMUST00000065111] [ENSMUST00000108232]
AlphaFold Q8K387
Predicted Effect probably benign
Transcript: ENSMUST00000040429
AA Change: A432T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048324
Gene: ENSMUSG00000040455
AA Change: A432T

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2e-19 PFAM
Pfam:UCH 190 761 2.8e-50 PFAM
Pfam:UCH_1 533 743 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065111
AA Change: A480T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067109
Gene: ENSMUSG00000040455
AA Change: A480T

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 4.1e-19 PFAM
Pfam:UCH 190 809 2.1e-45 PFAM
Pfam:UCH_1 581 790 9.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108232
AA Change: A480T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103867
Gene: ENSMUSG00000040455
AA Change: A480T

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2.2e-19 PFAM
Pfam:UCH 190 809 4.6e-50 PFAM
Pfam:UCH_1 582 791 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137293
SMART Domains Protein: ENSMUSP00000125982
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:zf-UBP 27 106 1.6e-20 PFAM
Pfam:UCH 157 205 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Usp45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Usp45 APN 4 21830433 missense probably benign 0.38
IGL02053:Usp45 APN 4 21824553 missense probably benign 0.43
IGL02155:Usp45 APN 4 21798743 splice site probably null
R0285:Usp45 UTSW 4 21798603 critical splice acceptor site probably null
R1260:Usp45 UTSW 4 21826204 missense probably damaging 1.00
R1495:Usp45 UTSW 4 21797385 missense possibly damaging 0.82
R1888:Usp45 UTSW 4 21784811 intron probably benign
R2444:Usp45 UTSW 4 21817528 missense probably benign 0.00
R2906:Usp45 UTSW 4 21834338 nonsense probably null
R4058:Usp45 UTSW 4 21810746 missense probably damaging 1.00
R4357:Usp45 UTSW 4 21834350 nonsense probably null
R4386:Usp45 UTSW 4 21830505 critical splice donor site probably null
R4648:Usp45 UTSW 4 21825044 missense probably benign 0.12
R4766:Usp45 UTSW 4 21797307 missense probably damaging 0.98
R4787:Usp45 UTSW 4 21796860 missense probably benign
R4973:Usp45 UTSW 4 21815372 missense probably damaging 1.00
R5152:Usp45 UTSW 4 21824815 missense probably benign 0.41
R5900:Usp45 UTSW 4 21830451 missense probably damaging 1.00
R5960:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R5961:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6149:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6150:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6151:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6997:Usp45 UTSW 4 21781844 missense probably damaging 1.00
R7504:Usp45 UTSW 4 21816892 missense possibly damaging 0.65
R7565:Usp45 UTSW 4 21784790 missense probably benign 0.00
R7750:Usp45 UTSW 4 21780430 missense probably damaging 1.00
R8043:Usp45 UTSW 4 21824543 missense probably benign 0.02
R8233:Usp45 UTSW 4 21781736 missense probably benign 0.33
R8237:Usp45 UTSW 4 21834274 missense probably damaging 0.98
R8868:Usp45 UTSW 4 21815399 critical splice donor site probably null
R8883:Usp45 UTSW 4 21825006 missense probably damaging 1.00
R9036:Usp45 UTSW 4 21832201 missense probably damaging 1.00
R9307:Usp45 UTSW 4 21824998 missense probably damaging 1.00
R9338:Usp45 UTSW 4 21784755 missense probably damaging 1.00
Z1176:Usp45 UTSW 4 21796847 missense possibly damaging 0.87
Z1176:Usp45 UTSW 4 21817613 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGCAGCTAAGTAGGACTTTAGTGG -3'
(R):5'- GGCTTGTGGCAATTCACTTG -3'

Sequencing Primer
(F):5'- GTGGCATTTGTTTCCAATAAGATCAC -3'
(R):5'- CACTTGCCAGTGGGAGGTG -3'
Posted On 2020-09-15