Incidental Mutation 'R7992:Tes'
ID 651803
Institutional Source Beutler Lab
Gene Symbol Tes
Ensembl Gene ENSMUSG00000029552
Gene Name testis derived transcript
Synonyms D6Ertd352e, Tes1, Tes2, testin, testin2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 17065149-17105828 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 17096243 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 77 (A77S)
Ref Sequence ENSEMBL: ENSMUSP00000111127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076654] [ENSMUST00000115467] [ENSMUST00000154266]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000076654
AA Change: A68S

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075950
Gene: ENSMUSG00000029552
AA Change: A68S

DomainStartEndE-ValueType
Pfam:PET 82 187 9.6e-46 PFAM
LIM 224 281 9.54e-12 SMART
LIM 289 341 5.35e-15 SMART
LIM 349 404 1.69e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115467
AA Change: A77S

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111127
Gene: ENSMUSG00000029552
AA Change: A77S

DomainStartEndE-ValueType
Pfam:PET 96 194 2.1e-44 PFAM
LIM 233 290 9.54e-12 SMART
LIM 298 350 5.35e-15 SMART
LIM 358 413 1.69e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154266
SMART Domains Protein: ENSMUSP00000118791
Gene: ENSMUSG00000029552

DomainStartEndE-ValueType
Pfam:PET 6 79 4e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cancer-associated chromosomal changes often involve regions containing fragile sites. This gene maps to a commom fragile site on chromosome 7q31.2 designated FRA7G. This gene is similar to mouse Testin, a testosterone-responsive gene encoding a Sertoli cell secretory protein containing three LIM domains. LIM domains are double zinc-finger motifs that mediate protein-protein interactions between transcription factors, cytoskeletal proteins and signaling proteins. This protein is a negative regulator of cell growth and may act as a tumor suppressor. This scaffold protein may also play a role in cell adhesion, cell spreading and in the reorganization of the actin cytoskeleton. Multiple protein isoforms are encoded by transcript variants of this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous and heterozygous null mice display small forestomachs with thickened epithelium and increased tumor incidence and malignancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Tes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Tes APN 6 17099879 missense probably damaging 1.00
IGL02070:Tes APN 6 17099780 missense probably damaging 1.00
R0501:Tes UTSW 6 17097558 missense probably benign
R1591:Tes UTSW 6 17097442 missense probably damaging 0.98
R1777:Tes UTSW 6 17104755 missense probably benign 0.02
R2968:Tes UTSW 6 17096234 missense probably benign 0.00
R3983:Tes UTSW 6 17099701 splice site probably null
R4532:Tes UTSW 6 17097408 missense possibly damaging 0.95
R4893:Tes UTSW 6 17104596 missense probably damaging 1.00
R4949:Tes UTSW 6 17100360 missense probably benign
R5026:Tes UTSW 6 17096340 missense probably benign 0.41
R6220:Tes UTSW 6 17086196 nonsense probably null
R6810:Tes UTSW 6 17104652 missense probably benign 0.12
R6903:Tes UTSW 6 17099863 missense probably damaging 0.99
R6987:Tes UTSW 6 17086155 missense probably benign 0.09
R7210:Tes UTSW 6 17104762 missense probably damaging 1.00
R7391:Tes UTSW 6 17096167 missense probably damaging 1.00
R7549:Tes UTSW 6 17099741 frame shift probably null
R7818:Tes UTSW 6 17099744 missense probably damaging 0.99
R7978:Tes UTSW 6 17096323 missense probably benign 0.00
R8052:Tes UTSW 6 17097292 missense probably benign 0.08
R8129:Tes UTSW 6 17065243 start gained probably benign
R8552:Tes UTSW 6 17097328 missense probably damaging 1.00
R8703:Tes UTSW 6 17099789 missense probably damaging 1.00
R9269:Tes UTSW 6 17100342 missense probably benign 0.25
R9556:Tes UTSW 6 17096234 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCATCACTGGTTAGGTGTAC -3'
(R):5'- ATGTCACAAAAGGAGCTGCC -3'

Sequencing Primer
(F):5'- CATCACTGGTTAGGTGTACTTGGTC -3'
(R):5'- AGGAGCTGCCCTAAATAATCTAG -3'
Posted On 2020-09-15