Incidental Mutation 'R7992:Fancd2'
ID651806
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene NameFanconi anemia, complementation group D2
Synonyms2410150O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7992 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113531682-113597017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113565204 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 770 (S770P)
Ref Sequence ENSEMBL: ENSMUSP00000045667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000129462] [ENSMUST00000204827]
PDB Structure Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: S770P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: S770P

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123738
SMART Domains Protein: ENSMUSP00000122091
Gene: ENSMUSG00000034023

DomainStartEndE-ValueType
Pfam:FancD2 1 246 5.7e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129462
SMART Domains Protein: ENSMUSP00000145220
Gene: ENSMUSG00000034023

DomainStartEndE-ValueType
Pfam:FancD2 1 80 4.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: S770P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: S770P

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1225:Fancd2 UTSW 6 113535861 missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113545038 missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113546622 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
R8757:Fancd2 UTSW 6 113560093 missense possibly damaging 0.91
R8960:Fancd2 UTSW 6 113563168 critical splice donor site probably null
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAAGTGGAAGGCGTTTTG -3'
(R):5'- ACAGCAGCAGGTACCAATGG -3'

Sequencing Primer
(F):5'- TTGAAATAAAACAAAGCTTGACTCTC -3'
(R):5'- ATCTCTGCTTCGGCCAGAGAAG -3'
Posted On2020-09-15