Incidental Mutation 'R7992:Rtkn2'
ID 651822
Institutional Source Beutler Lab
Gene Symbol Rtkn2
Ensembl Gene ENSMUSG00000037846
Gene Name rhotekin 2
Synonyms Plekhk1, B130039D23Rik, RTKN2, Mbf
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 67979570-68059740 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68040093 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 411 (P411S)
Ref Sequence ENSEMBL: ENSMUSP00000112946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068994] [ENSMUST00000105437] [ENSMUST00000117086] [ENSMUST00000118160] [ENSMUST00000147556]
AlphaFold Q14B46
Predicted Effect probably damaging
Transcript: ENSMUST00000068994
AA Change: P411S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070717
Gene: ENSMUSG00000037846
AA Change: P411S

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 93 243 4.9e-37 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105437
AA Change: P409S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101077
Gene: ENSMUSG00000037846
AA Change: P409S

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 241 3.1e-37 PFAM
PH 280 387 1.11e-6 SMART
low complexity region 527 541 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117086
AA Change: P408S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112419
Gene: ENSMUSG00000037846
AA Change: P408S

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118160
AA Change: P411S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112946
Gene: ENSMUSG00000037846
AA Change: P411S

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 94 242 1.4e-49 PFAM
PH 282 389 1.11e-6 SMART
low complexity region 529 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147556
AA Change: P408S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116166
Gene: ENSMUSG00000037846
AA Change: P408S

DomainStartEndE-ValueType
Blast:Hr1 12 75 4e-30 BLAST
Pfam:Anillin 90 240 4.9e-37 PFAM
PH 279 386 1.11e-6 SMART
low complexity region 526 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Rtkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rtkn2 APN 10 68041664 missense probably benign 0.00
IGL01338:Rtkn2 APN 10 68025519 missense possibly damaging 0.83
IGL01865:Rtkn2 APN 10 68035875 missense probably benign 0.44
IGL03074:Rtkn2 APN 10 68041721 missense probably damaging 0.99
IGL03383:Rtkn2 APN 10 68017837 missense probably damaging 1.00
PIT4520001:Rtkn2 UTSW 10 67987461 missense probably damaging 1.00
R1167:Rtkn2 UTSW 10 67997620 missense probably damaging 1.00
R2166:Rtkn2 UTSW 10 68041696 missense possibly damaging 0.55
R2323:Rtkn2 UTSW 10 68001934 missense probably damaging 1.00
R3826:Rtkn2 UTSW 10 67997626 splice site probably null
R3827:Rtkn2 UTSW 10 67997626 splice site probably null
R3828:Rtkn2 UTSW 10 67997626 splice site probably null
R3829:Rtkn2 UTSW 10 67997626 splice site probably null
R4742:Rtkn2 UTSW 10 68003314 missense possibly damaging 0.72
R4867:Rtkn2 UTSW 10 68001927 missense probably damaging 0.99
R4871:Rtkn2 UTSW 10 68005633 missense probably damaging 1.00
R4936:Rtkn2 UTSW 10 68041915 makesense probably null
R5009:Rtkn2 UTSW 10 68041409 missense probably benign 0.14
R5709:Rtkn2 UTSW 10 68001970 missense probably benign 0.31
R6295:Rtkn2 UTSW 10 67979699 start gained probably benign
R6307:Rtkn2 UTSW 10 68035832 missense possibly damaging 0.60
R6751:Rtkn2 UTSW 10 68041453 missense probably benign 0.43
R6823:Rtkn2 UTSW 10 68026632 missense probably damaging 0.96
R7011:Rtkn2 UTSW 10 67979665 unclassified probably benign
R7369:Rtkn2 UTSW 10 68041429 missense probably damaging 0.96
R7403:Rtkn2 UTSW 10 68005636 missense probably benign 0.18
R7760:Rtkn2 UTSW 10 68005609 missense probably damaging 1.00
R7803:Rtkn2 UTSW 10 67979813 critical splice donor site probably null
R9034:Rtkn2 UTSW 10 68005586 missense probably damaging 1.00
R9301:Rtkn2 UTSW 10 68035847 missense possibly damaging 0.85
R9383:Rtkn2 UTSW 10 68003264 missense possibly damaging 0.94
Z1177:Rtkn2 UTSW 10 68025603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAACCGGATTGTACTGG -3'
(R):5'- CAATTTTACTGTGCCCGGAG -3'

Sequencing Primer
(F):5'- ACTGGGTTTTTATGCAAGCTTC -3'
(R):5'- ACTGTGCCCGGAGAAGTTTAGC -3'
Posted On 2020-09-15