Incidental Mutation 'R7992:Stat2'
ID 651824
Institutional Source Beutler Lab
Gene Symbol Stat2
Ensembl Gene ENSMUSG00000040033
Gene Name signal transducer and activator of transcription 2
Synonyms 1600010G07Rik
MMRRC Submission 046033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.209) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 128106428-128128718 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128120831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 579 (F579L)
Ref Sequence ENSEMBL: ENSMUSP00000100872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000085708
AA Change: F578L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033
AA Change: F578L

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105238
AA Change: F579L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033
AA Change: F579L

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,904 (GRCm39) T1054A probably benign Het
Ankfn1 A C 11: 89,413,859 (GRCm39) I172S probably benign Het
Ano3 T C 2: 110,605,367 (GRCm39) T280A possibly damaging Het
Arhgef37 T A 18: 61,638,827 (GRCm39) E307D probably benign Het
Bptf C T 11: 107,001,709 (GRCm39) V468I probably benign Het
Ces1b A G 8: 93,786,987 (GRCm39) V464A probably benign Het
Cmc2 A T 8: 117,616,446 (GRCm39) L93* probably null Het
Ddx60 A G 8: 62,407,569 (GRCm39) D360G probably benign Het
Dock6 C T 9: 21,744,135 (GRCm39) probably null Het
Erp44 A G 4: 48,218,136 (GRCm39) F178L possibly damaging Het
Fam47e T C 5: 92,722,541 (GRCm39) V79A probably damaging Het
Fancd2 T C 6: 113,542,165 (GRCm39) S770P probably damaging Het
Fcgr1 A G 3: 96,191,897 (GRCm39) F304L probably benign Het
Fkbp15 T C 4: 62,230,538 (GRCm39) E725G probably damaging Het
Fn1 T C 1: 71,638,825 (GRCm39) I1971V probably benign Het
Gdf6 A G 4: 9,844,652 (GRCm39) S59G probably benign Het
Gm5773 T A 3: 93,680,373 (GRCm39) I15N possibly damaging Het
Hesx1 T C 14: 26,723,379 (GRCm39) S70P probably benign Het
Htr5a T C 5: 28,055,995 (GRCm39) S329P probably damaging Het
Htt T C 5: 34,987,225 (GRCm39) probably null Het
Iba57 T A 11: 59,052,288 (GRCm39) M118L unknown Het
Ifi35 C T 11: 101,348,307 (GRCm39) Q112* probably null Het
Il12rb1 G T 8: 71,265,233 (GRCm39) R183L possibly damaging Het
Il12rb2 A T 6: 67,328,311 (GRCm39) Y306* probably null Het
Ints1 C G 5: 139,742,282 (GRCm39) D1722H probably damaging Het
Ipp T G 4: 116,381,453 (GRCm39) D317E probably damaging Het
Kif26a A G 12: 112,142,481 (GRCm39) T912A probably benign Het
Klhdc7a A G 4: 139,693,045 (GRCm39) V634A probably damaging Het
Klhl40 C A 9: 121,607,748 (GRCm39) P303T probably damaging Het
Krt13 T C 11: 100,008,478 (GRCm39) T420A unknown Het
Lpcat2 T C 8: 93,582,186 (GRCm39) F35S probably damaging Het
Macf1 A G 4: 123,289,753 (GRCm39) V5470A probably damaging Het
Mta2 T C 19: 8,925,151 (GRCm39) probably null Het
Muc16 G T 9: 18,567,725 (GRCm39) T1598K unknown Het
Nckap5 A T 1: 125,954,547 (GRCm39) N668K probably damaging Het
Nlrp4a A T 7: 26,150,070 (GRCm39) D559V possibly damaging Het
Npat T C 9: 53,474,167 (GRCm39) L653P probably benign Het
Oog1 G A 12: 87,655,252 (GRCm39) V467I possibly damaging Het
Or4c15b A G 2: 89,113,082 (GRCm39) S132P probably benign Het
Or4f56 C T 2: 111,703,280 (GRCm39) A307T probably benign Het
Pdzph1 T A 17: 59,186,105 (GRCm39) M1229L possibly damaging Het
Piwil4 T A 9: 14,614,445 (GRCm39) Q106L Het
Plekha5 C A 6: 140,472,267 (GRCm39) R65S probably damaging Het
Ptger4 T C 15: 5,264,381 (GRCm39) Y425C probably damaging Het
Pus7 A G 5: 23,951,465 (GRCm39) M534T possibly damaging Het
Rtkn2 C T 10: 67,875,923 (GRCm39) P411S probably damaging Het
Scand1 G A 2: 156,154,232 (GRCm39) P13S unknown Het
Scaper T C 9: 55,765,438 (GRCm39) H550R probably benign Het
Senp5 T A 16: 31,796,514 (GRCm39) K617I probably damaging Het
Shq1 A G 6: 100,613,972 (GRCm39) L282P probably damaging Het
Slc12a6 T A 2: 112,166,256 (GRCm39) C227S probably damaging Het
Slc5a9 T A 4: 111,747,729 (GRCm39) T284S probably benign Het
Tes G T 6: 17,096,242 (GRCm39) A77S possibly damaging Het
Themis A T 10: 28,637,342 (GRCm39) T149S probably benign Het
Tmprss6 C T 15: 78,326,664 (GRCm39) R653H probably benign Het
Trmt6 G A 2: 132,652,959 (GRCm39) L107F probably damaging Het
Trpm6 T C 19: 18,792,714 (GRCm39) C713R probably damaging Het
Trpm7 T C 2: 126,667,454 (GRCm39) I820V probably benign Het
Usp45 G A 4: 21,824,543 (GRCm39) A432T probably benign Het
Xab2 A T 8: 3,668,622 (GRCm39) V82E possibly damaging Het
Zfp938 T A 10: 82,061,777 (GRCm39) Y281F possibly damaging Het
Other mutations in Stat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Stat2 APN 10 128,117,045 (GRCm39) missense probably benign 0.42
IGL02528:Stat2 APN 10 128,126,534 (GRCm39) missense probably benign 0.07
IGL02859:Stat2 APN 10 128,112,480 (GRCm39) missense probably damaging 1.00
IGL03119:Stat2 APN 10 128,119,386 (GRCm39) missense probably benign 0.15
numb UTSW 10 128,116,934 (GRCm39) splice site probably null
Paresthetic UTSW 10 128,117,111 (GRCm39) critical splice donor site probably null
1mM(1):Stat2 UTSW 10 128,113,592 (GRCm39) missense probably benign 0.06
R0098:Stat2 UTSW 10 128,119,131 (GRCm39) missense probably damaging 1.00
R0334:Stat2 UTSW 10 128,113,736 (GRCm39) missense probably damaging 1.00
R0496:Stat2 UTSW 10 128,112,378 (GRCm39) missense probably benign 0.04
R1478:Stat2 UTSW 10 128,117,969 (GRCm39) critical splice acceptor site probably null
R2857:Stat2 UTSW 10 128,112,770 (GRCm39) splice site probably null
R3698:Stat2 UTSW 10 128,114,662 (GRCm39) missense probably benign 0.30
R3870:Stat2 UTSW 10 128,113,762 (GRCm39) missense probably benign 0.17
R5231:Stat2 UTSW 10 128,117,111 (GRCm39) critical splice donor site probably null
R5235:Stat2 UTSW 10 128,126,901 (GRCm39) critical splice donor site probably null
R5264:Stat2 UTSW 10 128,116,934 (GRCm39) splice site probably null
R5855:Stat2 UTSW 10 128,119,363 (GRCm39) missense probably damaging 1.00
R6752:Stat2 UTSW 10 128,119,622 (GRCm39) missense probably damaging 1.00
R7459:Stat2 UTSW 10 128,112,434 (GRCm39) missense possibly damaging 0.95
R7467:Stat2 UTSW 10 128,113,772 (GRCm39) splice site probably null
R7599:Stat2 UTSW 10 128,113,066 (GRCm39) missense possibly damaging 0.45
R7756:Stat2 UTSW 10 128,126,597 (GRCm39) small deletion probably benign
R7814:Stat2 UTSW 10 128,126,597 (GRCm39) small deletion probably benign
R8335:Stat2 UTSW 10 128,112,452 (GRCm39) missense possibly damaging 0.77
R8825:Stat2 UTSW 10 128,127,233 (GRCm39) missense possibly damaging 0.70
R9052:Stat2 UTSW 10 128,117,538 (GRCm39) missense probably damaging 1.00
R9104:Stat2 UTSW 10 128,117,111 (GRCm39) critical splice donor site probably null
R9244:Stat2 UTSW 10 128,118,634 (GRCm39) missense possibly damaging 0.93
R9405:Stat2 UTSW 10 128,114,634 (GRCm39) missense probably damaging 0.99
R9433:Stat2 UTSW 10 128,112,657 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTCGATCAATGGACAGAGTTG -3'
(R):5'- AAGTGAGTGAGACTAGGCCC -3'

Sequencing Primer
(F):5'- GCTGGGATTAAAGGCATTCACTCC -3'
(R):5'- GGGGTTCCCAGACCAAACAG -3'
Posted On 2020-09-15