Incidental Mutation 'R7992:Adamts12'
ID 651834
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
Synonyms AI605170; ADAMTS-12
MMRRC Submission
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 11064790-11349231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11310818 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1054 (T1054A)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: T1054A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: T1054A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
R9042:Adamts12 UTSW 15 11152048 missense probably benign 0.08
R9162:Adamts12 UTSW 15 11311635 missense probably benign 0.29
R9190:Adamts12 UTSW 15 11336360 missense probably benign 0.02
R9700:Adamts12 UTSW 15 11311356 missense probably benign 0.04
R9748:Adamts12 UTSW 15 11310542 missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAGCAGTGCCCATTTAGC -3'
(R):5'- GTGGTTGCCCAAAAGTCAC -3'

Sequencing Primer
(F):5'- TTAGCCGTAGAGTTCTGAAACCC -3'
(R):5'- CCTCTGAAGTAGGACCTATAGCTG -3'
Posted On 2020-09-15